Search result for sequence:
TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG
common ontology terms
term enrichment score
TermScore
homo sapiens0.606043
adult0.362587
feces0.300102
united states of america0.298695
saliva0.294372
child0.230633
infant0.187384
mouth0.144672
dentition0.105901
china0.097032
rural community0.083018
control0.082092
state of california0.072140
subgingival plaque0.071111
australia0.069079
ulcerative colitis0.064806
skin0.061141
supragingival plaque0.058319
no dental caries0.053571
oral cavity0.053097
female0.052307
4-year-old human stage0.052012
supragingival dental plaque0.051724
africa0.051565
1-year-old human stage0.051126
brazil0.047863
city0.047602
finland0.044860
kingdom of denmark0.043796
human adult stage0.041026
bolivia0.040968
obsolete_juvenile stage0.040968
mouth mucosa0.040348
nigeria0.040146
hunter gatherer0.037383
oral wash0.037383
india0.037244
6-12 year-old child stage0.037037
pair of nares0.036832
state of new york0.036530
2-year-old human stage0.036474
poland0.035714
sputum0.034059
edo state0.033771
state of michigan0.033629
state of texas0.033488
hospital0.033488
adolescent stage0.033028
venezuela0.030361
amerindian0.030361
age < 3 years0.030361
state of victoria0.030132
crohn's disease0.029758
human late adulthood stage0.029685
duodenum0.029466
jiangsu province0.027634
chuquisaca department0.026465
lung0.026291
state of colorado0.026006
age 5-13 years0.025783
sweden0.025347
atlanta0.022901
central african republic0.022901
bronchial epithelium0.022857
homosexual0.022770
msm0.022770
hispanic or latin american0.022770
1-month-old human stage0.022599
diarrhea0.022514
dental plaque0.022514
united kingdom0.022326
commonwealth of pennsylvania0.022263
belgium0.022140
israel0.022079
LOWER IN control0.022069
japan0.021314
state of florida0.020979
canada0.020725
trachea0.019169
18-month-old human stage0.019169
colombia0.019139
non-smoker0.019139
village0.019108
research facility0.019095
depth < 3mm0.019048
shallow pocket depth0.019048
bangui0.019048
stunted growth0.019048
himalayas0.019048
LOWER IN supragingival plaque0.019048
municipality of umea0.019048
LOWER IN dentition0.019011
low bmi0.019002
young adult stage0.018987
san diego0.018957
12-month-old human stage0.018927
biopsy0.018868
sichuan province0.018868
nepal0.018868
shanghai district0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
trachea0.750000
18-month-old human stage0.750000
LOWER IN smoker0.750000
sputum0.666667
nectar0.666667
venezuela0.666667
amerindian0.666667
arm0.666667
bronchus0.666667
atlanta0.666667
bangladesh0.666667
building0.666667
colombia0.666667
age < 3 years0.666667
central african republic0.666667
metabolic syndrome0.666667
tracheal aspirate0.666667
LOWER IN 2-month-old human stage0.666667
non-smoker0.666667
9-month-old human stage0.666667
LOWER IN 18-month-old human stage0.666667
late adult stage0.666667
mouth0.640000
bronchial epithelium0.600000
flower0.600000
finland0.600000
village0.600000
4-year-old human stage0.600000
LOWER IN cigarette smoking0.600000
rural community0.588235
saliva0.557377
infant0.514286
LOWER IN chronic gastritis0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
children0.500000
mammalian milk beverage0.500000
LOWER IN sebum0.500000
LOWER IN axilla0.500000
LOWER IN inguinal region0.500000
sebum0.500000
bolivia0.500000
LOWER IN centenerians0.500000
hypopharynx0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN sewer0.500000
low income0.500000
nicotiana galuca0.500000
LOWER IN skin under eye0.500000
obsolete_juvenile stage0.500000
hunter gatherer0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
LOWER IN influenza0.500000
mallard0.500000
cheek0.500000
moscow0.500000
pulpitis0.500000
quail0.500000
coturnix coturnix0.500000
acute respiratory illness0.500000
brackish water0.500000
caspian sea0.500000
sediment depth 12-35cm0.500000
periodontal pocket0.500000
skh-1 hairless mouse0.500000
urban biome0.500000
train0.500000
13-year-old human stage0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
kitchen0.500000
sink0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
respiratory airway0.500000
north america0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN ocean0.500000
LOWER IN depth (water) 25cm0.500000
LOWER IN ulcer0.500000
LOWER IN wound0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
LOWER IN burrow0.500000
bon portage island0.500000
LOWER IN russia0.500000
cheyenne0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.877670
feces0.394175
adult0.363107
united states of america0.355340
saliva0.200000
child0.159223
infant0.114563
china0.102913
mouth0.081553
control0.062136
dentition0.060194
rural community0.044660
state of california0.040777
australia0.040777
subgingival plaque0.038835
female0.034951
skin0.034951
ulcerative colitis0.034951
supragingival plaque0.033010
oral cavity0.029126
supragingival dental plaque0.029126
no dental caries0.029126
1-year-old human stage0.027184
brazil0.027184
africa0.027184
4-year-old human stage0.027184
city0.025243
kingdom of denmark0.023301
finland0.023301
human adult stage0.023301
bolivia0.021359
obsolete_juvenile stage0.021359
mouth mucosa0.021359
nigeria0.021359
pair of nares0.019417
india0.019417
hunter gatherer0.019417
oral wash0.019417
6-12 year-old child stage0.019417
state of new york0.019417
poland0.019417
2-year-old human stage0.019417
sputum0.017476
state of michigan0.017476
state of texas0.017476
adolescent stage0.017476
hospital0.017476
edo state0.017476
duodenum0.015534
crohn's disease0.015534
LOWER IN control0.015534
venezuela0.015534
amerindian0.015534
age < 3 years0.015534
jiangsu province0.015534
human late adulthood stage0.015534
state of victoria0.015534
lung0.013592
research facility0.013592
state of colorado0.013592
sweden0.013592
chuquisaca department0.013592
age 5-13 years0.013592
bronchial epithelium0.011650
israel0.011650
atlanta0.011650
diarrhea0.011650
united kingdom0.011650
canada0.011650
1-month-old human stage0.011650
belgium0.011650
state of florida0.011650
homosexual0.011650
msm0.011650
commonwealth of pennsylvania0.011650
central african republic0.011650
japan0.011650
hispanic or latin american0.011650
dental plaque0.011650
biopsy0.009709
mucus0.009709
sichuan province0.009709
age0.009709
new york city0.009709
male0.009709
trachea0.009709
LOWER IN dentition0.009709
germany0.009709
low bmi0.009709
south korea0.009709
san diego0.009709
colombia0.009709
italy0.009709
air0.009709
12-month-old human stage0.009709
atlantic ocean0.009709
depth < 3mm0.009709
shallow pocket depth0.009709
thailand0.009709
bangui0.009709
Number of experiments associating the term to the sequence
TermScore
homo sapiens168.000000
feces102.000000
adult84.000000
united states of america76.000000
saliva34.000000
control26.000000
child23.000000
china19.000000
infant18.000000
mouth16.000000
dentition11.000000
city10.000000
skin10.000000
state of california10.000000
rural community10.000000
female8.000000
LOWER IN control8.000000
subgingival plaque8.000000
ulcerative colitis8.000000
australia7.000000
crohn's disease6.000000
1-year-old human stage6.000000
research facility6.000000
finland6.000000
oral cavity6.000000
human adult stage6.000000
pair of nares5.000000
india5.000000
obsolete_juvenile stage5.000000
brazil5.000000
LOWER IN dentition5.000000
human late adulthood stage5.000000
LOWER IN supragingival plaque5.000000
duodenum4.000000
sputum4.000000
lung4.000000
age4.000000
kingdom of denmark4.000000
israel4.000000
male4.000000
state of michigan4.000000
state of texas4.000000
low bmi4.000000
united kingdom4.000000
supragingival plaque4.000000
mouth mucosa4.000000
colombia4.000000
air4.000000
hospital4.000000
oral wash4.000000
homosexual4.000000
msm4.000000
6-12 year-old child stage4.000000
state of new york4.000000
non-smoker4.000000
biopsy3.000000
bronchial epithelium3.000000
sichuan province3.000000
small village3.000000
flower3.000000
hunter gatherer3.000000
trachea3.000000
diarrhea3.000000
south korea3.000000
canada3.000000
1-month-old human stage3.000000
12-month-old human stage3.000000
adolescent stage3.000000
state of colorado3.000000
commonwealth of pennsylvania3.000000
africa3.000000
young adult stage3.000000
japan3.000000
sweden3.000000
village3.000000
supragingival dental plaque3.000000
2-year-old human stage3.000000
4-year-old human stage3.000000
18-month-old human stage3.000000
LOWER IN smoker3.000000
LOWER IN cigarette smoking3.000000
LOWER IN left colon2.000000
bolivia2.000000
nectar2.000000
new york city2.000000
venezuela2.000000
amerindian2.000000
arm2.000000
bronchus2.000000
atlanta2.000000
germany2.000000
bangladesh2.000000
san diego2.000000
urban biome2.000000
13-year-old human stage2.000000
building2.000000
age < 3 years2.000000
italy2.000000
belgium2.000000
atlantic ocean2.000000
state of florida2.000000
thailand2.000000
central african republic2.000000
metabolic syndrome2.000000
tracheal aspirate2.000000
nigeria2.000000
poland2.000000
hispanic or latin american2.000000
LOWER IN 2-month-old human stage2.000000
9-month-old human stage2.000000
LOWER IN 18-month-old human stage2.000000
late adult stage2.000000
LOWER IN chronic gastritis1.000000
LOWER IN chronic fatigue syndrome1.000000
new york county1.000000
LOWER IN transverse colon1.000000
children1.000000
mammalian milk beverage1.000000
mucus1.000000
LOWER IN sebum1.000000
LOWER IN axilla1.000000
LOWER IN inguinal region1.000000
sebum1.000000
LOWER IN centenerians1.000000
hypopharynx1.000000
el salvador1.000000
LOWER IN lima1.000000
LOWER IN shantytown1.000000
LOWER IN sewer1.000000
low income1.000000
nicotiana galuca1.000000
LOWER IN skin under eye1.000000
tropical grassland biome1.000000
nanger granti1.000000
gazelle1.000000
LOWER IN influenza1.000000
mallard1.000000
cheek1.000000
moscow1.000000
pulpitis1.000000
quail1.000000
coturnix coturnix1.000000
acute respiratory illness1.000000
brackish water1.000000
caspian sea1.000000
sediment depth 12-35cm1.000000
periodontal pocket1.000000
skh-1 hairless mouse1.000000
train1.000000
bathroom1.000000
shower1.000000
tile1.000000
building wall1.000000
kitchen1.000000
sink1.000000
carnegiea gigantea1.000000
saguaro1.000000
decaying1.000000
pachycereus pringlei1.000000
cardon1.000000
respiratory airway1.000000
north america1.000000
exhaled air condensate1.000000
whale blow1.000000
LOWER IN ocean1.000000
LOWER IN depth (water) 25cm1.000000
LOWER IN ulcer1.000000
LOWER IN wound1.000000
oceanodroma leucorhoa1.000000
seabird1.000000
LOWER IN burrow1.000000
bon portage island1.000000
LOWER IN russia1.000000
cheyenne1.000000
depth < 3mm1.000000
shallow pocket depth1.000000
bangui1.000000
stunted growth1.000000
jiangsu province1.000000
nepal1.000000
himalayas1.000000
chuquisaca department1.000000
age 5-13 years1.000000
shanghai district1.000000
dental plaque1.000000
state of victoria1.000000
no dental caries1.000000
edo state1.000000
municipality of umea1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
460amnonhigher in occupied indoor air compared to outdoor air ( high in indoor office compared to outdoor in united states of america air state of california )2019-01-12v41 / 1approvedNo
102amnon high in hiv infection compared to control in homo sapiens united states of america dentition atlanta mouth 2017-04-04v41 / 4approvedNo
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v41 / 5approvedNo
102amnon high in control compared to periodontitis in homo sapiens united states of america atlanta mouth 2017-04-04v41 / 7approvedNo
517amnondominant homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v41 / 8approvedNo
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v41 / 9approvedNo
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v41 / 10approvedNo
58amnondominant homo sapiens, conjunctiva, new york city2017-02-02v41 / 10approvedNo
418amnondominant ocean, tissue, coral, echinopora mammiformis2018-12-02v41 / 10approvedNo
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v41 / 10approvedNo
919amnoncommon homo sapiens, saliva, infant, australia, state of victoria, 1-month-old human stage, 2-month-old human stage2022-07-17v41 / 10approvedNo
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v41 / 11approvedNo
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v41 / 11approvedNo
567amnoncommon homo sapiens, nasopharynx, adult, belgium2019-12-05v41 / 11approvedNo
919amnondominant homo sapiens, saliva, infant, australia, state of victoria2022-07-17v41 / 11approvedNo
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v41 / 12approvedNo
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v41 / 12approvedNo
975amnoncommon intestine, hindgut, pacific ocean, fish, gut content, isla coronado norte, argyropelecus affinis, depth (water) 500-1000m, hatchetfish2022-12-24v41 / 12approvedNo
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v41 / 13approvedNo
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v41 / 13approvedNo
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v41 / 13approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v41 / 13approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 13approvedNo
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v41 / 14approvedNo
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 14approvedNo
277amnondominant homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v41 / 14approvedNo
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v41 / 14approvedNo
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v41 / 14approvedNo
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v41 / 14approvedNo
919amnondominant homo sapiens, saliva, infant, australia, state of victoria, 10-month-old human stage, 11-month-old human stage, 12-month-old human stage, 13-month-old human stage, 14-month-old human stage2022-07-17v41 / 14approvedNo
1034amnondominant homo sapiens, united states of america, mouth mucosa, adult, buccal mucosa, young adult stage2023-08-14v41 / 14pendingNo
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v41 / 15approvedNo
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v41 / 15approvedNo
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v41 / 15approvedNo
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v41 / 15approvedNo
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v41 / 15approvedNo
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v41 / 15approvedNo
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v41 / 15approvedNo
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v41 / 15approvedNo
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v41 / 15approvedNo
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v41 / 15approvedNo
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v41 / 15approvedNo
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v41 / 15approvedNo
919amnondominant homo sapiens, saliva, infant, australia, state of victoria, 2-year-old human stage, 18-month-old human stage, 19-month-old human stage, 20-month-old human stage, 21-month-old human stage2022-07-17v41 / 15approvedNo
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v41 / 16approvedNo
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in feces homo sapiens sichuan province )2016-12-06v41 / 16approvedNo
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v41 / 16approvedNo
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v41 / 16approvedNo
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v41 / 16approvedNo
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v41 / 16approvedNo
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v41 / 16approvedNo
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v41 / 16approvedNo
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v41 / 16approvedNo
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v41 / 16approvedNo
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v41 / 16approvedNo
892amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v41 / 16approvedNo
922amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage, no dental caries2022-07-25v41 / 16approvedNo
945amnondominant homo sapiens, united states of america, oral cavity, adult, oral wash2022-11-29v41 / 16approvedNo
1089amnondominant homo sapiens, united states of america, saliva, adult, state of new jersey, human adult stage2024-04-25v41 / 16pendingNo
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v41 / 17approvedNo
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v41 / 17approvedNo
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v41 / 17approvedNo
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v41 / 17approvedNo
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v41 / 17approvedNo
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v41 / 17approvedNo
852amnondominant homo sapiens, saliva, adult, canada, non-smoker2021-12-17v41 / 17approvedNo
892amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v41 / 17approvedNo
922amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage, no dental caries2022-07-25v41 / 17approvedNo
960amnondominant homo sapiens, oral cavity, infant, nigeria, edo state, 15-month-old human stage2022-12-20v41 / 17approvedNo
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v41 / 18approvedNo
246amnondominant homo sapiens, saliva, italy2017-11-21v41 / 18approvedNo
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v41 / 18approvedNo
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v41 / 18approvedNo
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v41 / 18approvedNo
715amnondominant homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v41 / 18approvedNo
841amnondominant homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v41 / 18approvedNo
892amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v41 / 18approvedNo
892amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v41 / 18approvedNo
922amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-07-25v41 / 18approvedNo
922amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage, no dental caries2022-07-25v41 / 18approvedNo
957amnondominant homo sapiens, saliva, adult, india, pune2022-12-18v41 / 18approvedNo
1075amnondominant in sputum of hiv infected children with chronic lung disease (dominant homo sapiens, sputum, hiv infection, child, africa, chronic lung disease, human immunodeficiency virus infectious disease, malawi, zimbabwe, harare, blantyre city, 6-12 year-old child stage, adolescent stage)2024-01-15v41 / 18pendingNo
54amnondominant homo sapiens, united states of america, saliva2017-01-23v41 / 19approvedNo
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v41 / 19approvedNo
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v41 / 19approvedNo
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v41 / 19approvedNo
449amnondominant feces, homo sapiens, colombia2019-01-09v41 / 19approvedNo
1048amnondominant homo sapiens, saliva, child, israel, 6-12 year-old child stage2023-08-22v41 / 19pendingNo
45amnonhigh freq. in feces babies <2 years in india (dominant feces, homo sapiens, infant, india)2016-12-19v41 / 20approvedNo
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v41 / 20approvedNo
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v41 / 20approvedNo
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v41 / 20approvedNo
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v41 / 20approvedNo
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v41 / 20approvedNo
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v41 / 20approvedNo
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v41 / 20approvedNo
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v41 / 20approvedNo
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v41 / 20approvedNo
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v41 / 20approvedNo
892amnondominant homo sapiens, united states of america, infant, supragingival plaque, dental plaque, supragingival dental plaque, 1-year-old human stage2022-04-07v41 / 20approvedNo
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v41 / 20approvedNo
922amnondominant homo sapiens, united states of america, dentition, infant, supragingival plaque, supragingival dental plaque, 1-year-old human stage, no dental caries2022-07-25v41 / 20approvedNo
922amnondominant homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 4-year-old human stage, no dental caries2022-07-25v41 / 20approvedNo
1074amnondominant homo sapiens, saliva, late adult stage, adult, kingdom of the netherlands, finland, human late adulthood stage2024-01-12v41 / 20pendingNo
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v41 / 21approvedNo
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v41 / 21approvedNo
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v41 / 21approvedNo
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v41 / 21approvedNo
203amnondominant homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v41 / 21approvedNo
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v41 / 21approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v41 / 21approvedNo
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v41 / 21approvedNo
773amnondominant homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v41 / 21approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 21approvedNo
988amnondominant homo sapiens, tonsil, male, australia, homosexual, msm, young adult stage, tonsil surface2022-12-26v41 / 21approvedNo
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth adult czech republic 2020-01-09v31 / 21approvedNo
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v41 / 22approvedNo
96amnondominant homo sapiens, brazil, subgingival plaque, mouth2017-03-29v41 / 22approvedNo
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 22approvedNo
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v41 / 22approvedNo
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v41 / 22approvedNo
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v41 / 22approvedNo
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v41 / 22approvedNo
425amnondominant homo sapiens, duodenum, child, africa, madagascar, stunted growth, antananarivo2018-12-08v41 / 22approvedNo
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v41 / 22approvedNo
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v41 / 22approvedNo
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v41 / 22approvedNo
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v41 / 22approvedNo
1033amnondominant homo sapiens, saliva, adult, finland, helsinki, human late adulthood stage, stimulated saliva2023-08-14v41 / 22pendingNo
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v41 / 23approvedNo
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v41 / 23approvedNo
242amnonhigher in native-americans compared to non native-american ( high in cheyenne native american arapaho compared to american in feces homo sapiens united states of america state of oklahoma )2017-11-14v41 / 23approvedNo
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v41 / 23approvedNo
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v41 / 23approvedNo
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v41 / 23approvedNo
773amnondominant homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v41 / 23approvedNo
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v41 / 23approvedNo
922amnondominant homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 2-year-old human stage, no dental caries2022-07-25v41 / 23approvedNo
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v41 / 24approvedNo
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v41 / 24approvedNo
202amnondominant homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v41 / 24approvedNo
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v41 / 24approvedNo
260amnondominant homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v41 / 24approvedNo
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v41 / 24approvedNo
959amnondominant feces, homo sapiens, united states of america, ulcerative colitis, child, state of california, ulcerative colitis, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 24approvedNo
960amnoncommon feces, homo sapiens, infant, nigeria, edo state, 9-month-old human stage2022-12-20v41 / 24approvedNo
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v41 / 25approvedNo
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v41 / 25approvedNo
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v41 / 25approvedNo
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v41 / 25approvedNo
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v41 / 25approvedNo
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v41 / 25approvedNo
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v41 / 25approvedNo
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v41 / 25approvedNo
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v41 / 27approvedNo
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v41 / 27approvedNo
959amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america child state of california los angeles 6-12 year-old child stage adolescent stage 2022-12-19v41 / 27approvedNo
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v41 / 28approvedNo
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens dentition adult brazil subgingival plaque mouth periodontitis 2018-09-13v41 / 28approvedNo
841amnon high in iga positive fraction compared to iga negative fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v41 / 28approvedNo
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v41 / 29approvedNo
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v41 / 29approvedNo
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v41 / 29approvedNo
892amnoncommon homo sapiens, united states of america, infant, supragingival plaque, dental plaque, supragingival dental plaque, 1-year-old human stage2022-04-07v41 / 29approvedNo
922amnoncommon homo sapiens, united states of america, dentition, infant, supragingival plaque, supragingival dental plaque, 1-year-old human stage, no dental caries2022-07-25v41 / 29approvedNo
3amnondominant homo sapiens, tongue, china2016-10-06v41 / 30approvedNo
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v41 / 30approvedNo
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v41 / 30approvedNo
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v41 / 30approvedNo
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v41 / 30approvedNo
960amnoncommon feces, homo sapiens, infant, nigeria, edo state, 15-month-old human stage2022-12-20v41 / 30approvedNo
1033amnon high in non-smoker compared to nicotine dependence smoker cigarette smoking in homo sapiens saliva adult finland helsinki human late adulthood stage stimulated saliva 2023-08-14v41 / 30pendingNo
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v41 / 31approvedNo
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v41 / 31approvedNo
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v41 / 32approvedNo
354amnon high in sputum induced sputum compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v41 / 32approvedNo
1043amnonpositvelyl correlated with age in adult human feces ( high in human late adulthood stage compared to human early adulthood stage in feces homo sapiens adult japan human adult stage )2023-08-20v41 / 32pendingNo
354amnon high in saliva oral wash compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v41 / 33approvedNo
892amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v41 / 33approvedNo
922amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage, no dental caries2022-07-25v41 / 33approvedNo
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v41 / 34approvedNo
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v41 / 34approvedNo
919amnoncommon 6-month-old human stage, 7-month-old human stage, 8-month-old human stage, 9-month-old human stage, homo sapiens, saliva, infant, australia, state of victoria2022-07-17v41 / 34approvedNo
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v41 / 35approvedNo
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v41 / 36approvedNo
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v41 / 36approvedNo
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v41 / 36approvedNo
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v41 / 36approvedNo
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v41 / 36approvedNo
960amnoncommon homo sapiens, oral cavity, infant, nigeria, edo state, 15-month-old human stage2022-12-20v41 / 36approvedNo
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v41 / 37approvedNo
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v41 / 37approvedNo
1034amnoncommon homo sapiens, united states of america, mouth mucosa, adult, buccal mucosa, young adult stage2023-08-14v41 / 37pendingNo
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v41 / 38approvedNo
1075amnon high in zimbabwe harare compared to malawi blantyre city in homo sapiens sputum hiv infection child africa chronic lung disease human immunodeficiency virus infectious disease 6-12 year-old child stage adolescent stage 2024-01-15v41 / 38pendingNo
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v41 / 39approvedNo
959amnoncommon feces, homo sapiens, united states of america, ulcerative colitis, child, state of california, ulcerative colitis, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 39approvedNo
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v41 / 40approvedNo
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v41 / 40approvedNo
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v41 / 40approvedNo
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v41 / 41approvedNo
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v41 / 41approvedNo
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v41 / 41approvedNo
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v41 / 42approvedNo
922amnoncommon homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 4-year-old human stage, no dental caries2022-07-25v41 / 42approvedNo
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v41 / 43approvedNo
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v41 / 43approvedNo
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v41 / 44approvedNo
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v41 / 44approvedNo
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v41 / 45approvedNo
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v41 / 46approvedNo
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v41 / 46approvedNo
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v41 / 46approvedNo
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v41 / 47approvedNo
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v41 / 47approvedNo
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v41 / 48approvedNo
922amnoncommon homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 2-year-old human stage, no dental caries2022-07-25v41 / 48approvedNo
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v41 / 50approvedNo
960amnoncommon feces, homo sapiens, infant, nigeria, edo state, 18-month-old human stage2022-12-20v41 / 50approvedNo
63amnon high in normal stool compared to hard stool constipation in feces homo sapiens united states of america 2023-11-13v41 / 51pendingNo
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v41 / 52approvedNo
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v41 / 52approvedNo
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v41 / 53approvedNo
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v41 / 54approvedNo
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v41 / 54approvedNo
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v41 / 55approvedNo
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v41 / 55approvedNo
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v41 / 55approvedNo
1074amnoncommon homo sapiens, saliva, late adult stage, adult, kingdom of the netherlands, finland, human late adulthood stage2024-01-12v41 / 55pendingNo
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v41 / 56approvedNo
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v41 / 56approvedNo
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v41 / 56approvedNo
922amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage, no dental caries2022-07-25v41 / 56approvedNo
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v41 / 57approvedNo
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v41 / 57approvedNo
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v41 / 57approvedNo
892amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v41 / 57approvedNo
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v41 / 58approvedNo
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v41 / 59approvedNo
892amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v41 / 59approvedNo
922amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage, no dental caries2022-07-25v41 / 59approvedNo
149amnoncommon stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander2017-04-24v41 / 60approvedNo
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v41 / 60approvedNo
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v41 / 61approvedNo
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v41 / 61approvedNo
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v41 / 62approvedNo
919amnoncommon homo sapiens, saliva, infant, australia, state of victoria, 10-month-old human stage, 11-month-old human stage, 12-month-old human stage, 13-month-old human stage, 14-month-old human stage2022-07-17v41 / 62approvedNo
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v41 / 63approvedNo
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v41 / 63approvedNo
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v41 / 64approvedNo
957amnoncommon homo sapiens, saliva, adult, india, pune2022-12-18v41 / 64approvedNo
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v41 / 65approvedNo
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v41 / 65approvedNo
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v41 / 65approvedNo
919amnoncommon homo sapiens, saliva, infant, australia, state of victoria, 2-year-old human stage, 18-month-old human stage, 19-month-old human stage, 20-month-old human stage, 21-month-old human stage2022-07-17v41 / 65approvedNo
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v41 / 66approvedNo
852amnoncommon homo sapiens, saliva, adult, canada, non-smoker2021-12-17v41 / 66approvedNo
1033amnoncommon homo sapiens, saliva, adult, finland, helsinki, human late adulthood stage, stimulated saliva2023-08-14v41 / 66pendingNo
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v41 / 67approvedNo
941amnoncommon feces, homo sapiens, farm, adult, thailand, rural community, village, nan province, chicken farm2022-11-25v41 / 67approvedNo
941amnoncommon feces, homo sapiens, adult, thailand, rural community, village, nan province2022-11-25v41 / 67approvedNo
945amnoncommon homo sapiens, united states of america, oral cavity, adult, oral wash2022-11-29v41 / 67approvedNo
805amnon high in non-smoker compared to nicotine dependence smoker cigarette smoking in homo sapiens sputum adult united kingdom city of london 2021-06-18v31 / 67approvedNo
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v41 / 68approvedNo
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v41 / 69approvedNo
941amnoncommon feces, homo sapiens, farm, adult, thailand, rural community, village, nan province, pig farm2022-11-25v41 / 69approvedNo
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v41 / 71approvedNo
1075amnoncommon in sputum of hiv infected children with chronic lung disease (common homo sapiens, sputum, hiv infection, child, africa, chronic lung disease, human immunodeficiency virus infectious disease, malawi, zimbabwe, harare, blantyre city, 6-12 year-old child stage, adolescent stage)2024-01-15v41 / 71pendingNo
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v41 / 73approvedNo
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v41 / 73approvedNo
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v41 / 74approvedNo
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v41 / 75approvedNo
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v41 / 75approvedNo
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v41 / 76approvedNo
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v41 / 76approvedNo
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v41 / 76approvedNo
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v41 / 77approvedNo
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v41 / 77approvedNo
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v41 / 77approvedNo
1048amnoncommon homo sapiens, saliva, child, israel, 6-12 year-old child stage2023-08-22v41 / 77pendingNo
1089amnoncommon homo sapiens, united states of america, saliva, adult, state of new jersey, human adult stage2024-04-25v41 / 78pendingNo
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v41 / 79approvedNo
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v41 / 79approvedNo
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v41 / 80approvedNo
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v41 / 80approvedNo
3amnoncommon homo sapiens, tongue, china2016-10-06v41 / 81approvedNo
203amnoncommon homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v41 / 81approvedNo
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v41 / 81approvedNo
339amnoncommon feces, homo sapiens, adult, india2018-05-24v41 / 81approvedNo
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens nasopharynx infant australia )2017-04-16v41 / 83approvedNo
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v41 / 83approvedNo
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v31 / 83approvedNo
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v41 / 84approvedNo
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v41 / 84approvedNo
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v41 / 84approvedNo
961amnoncommon feces, homo sapiens, child, kingdom of denmark, zealand, 4-year-old human stage2022-12-20v41 / 84approvedNo
972amnoncommon feces, homo sapiens, united states of america, adult, state of california2022-12-24v41 / 84approvedNo
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v41 / 85approvedNo
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v41 / 85approvedNo
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v41 / 85approvedNo
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v41 / 85approvedNo
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v41 / 86approvedNo
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v41 / 86approvedNo
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v41 / 86approvedNo
947amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania2022-12-02v41 / 86approvedNo
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v41 / 87approvedNo
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v41 / 87approvedNo
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v41 / 87approvedNo
892amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v41 / 87approvedNo
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v41 / 88approvedNo
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v41 / 88approvedNo
922amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-07-25v41 / 88approvedNo
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v41 / 89approvedNo
988amnoncommon homo sapiens, tonsil, male, australia, homosexual, msm, young adult stage, tonsil surface2022-12-26v41 / 89approvedNo
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v41 / 90approvedNo
958amnoncommon feces, homo sapiens, united states of america, adult, state of texas, mexico, mexican american2022-12-19v41 / 91approvedNo
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v41 / 92approvedNo
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v41 / 92approvedNo
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v31 / 92approvedNo
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v41 / 93approvedNo
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v41 / 93approvedNo
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v41 / 94approvedNo
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v41 / 94approvedNo
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v41 / 94approvedNo
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v41 / 95approvedNo
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v41 / 95approvedNo
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v41 / 96approvedNo
238amnoncommon feces, homo sapiens, colombia2017-11-07v41 / 96approvedNo
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v41 / 96approvedNo
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v41 / 97approvedNo
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v41 / 97approvedNo
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v41 / 98approvedNo
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v41 / 100approvedNo
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v41 / 100approvedNo
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v41 / 100approvedNo
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v41 / 100approvedNo
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v41 / 101approvedNo
961amnoncommon feces, homo sapiens, child, kingdom of denmark, zealand, 6-year-old human stage2022-12-20v41 / 101approvedNo
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v41 / 102approvedNo
877amnoncommon feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v41 / 102approvedNo
922amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage no dental caries 2022-07-25v41 / 102approvedNo
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v41 / 103approvedNo
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v41 / 103approvedNo
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v41 / 104approvedNo
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v41 / 105approvedNo
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v41 / 105approvedNo
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v41 / 106approvedNo
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v41 / 106approvedNo
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v41 / 107approvedNo
215amnoncommon feces, homo sapiens, united states of america2017-10-23v41 / 107approvedNo
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth (water) 0cm in united states of america atlantic ocean state of florida south florida )2018-04-24v41 / 107approvedNo
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 107approvedNo
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v41 / 107approvedNo
892amnon high in saliva compared to supragingival plaque dental plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage 2022-04-07v41 / 107approvedNo
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v41 / 108approvedNo
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v41 / 109approvedNo
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v41 / 109approvedNo
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v41 / 109approvedNo
960amnoncommon feces, homo sapiens, female, adult, nigeria, edo state2022-12-20v41 / 109approvedNo
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v41 / 110approvedNo
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v41 / 110approvedNo
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v41 / 111approvedNo
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v41 / 111approvedNo
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v41 / 111approvedNo
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v41 / 112approvedNo
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v41 / 113approvedNo
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v41 / 113approvedNo
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v41 / 115approvedNo
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v41 / 116approvedNo
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v41 / 116approvedNo
239amnoncommon feces, homo sapiens, united states of america2017-11-08v41 / 117approvedNo
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v41 / 117approvedNo
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v41 / 118approvedNo
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v41 / 120approvedNo
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v41 / 121approvedNo
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v41 / 121approvedNo
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v41 / 121approvedNo
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v41 / 123approvedNo
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v41 / 123approvedNo
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v41 / 124approvedNo
449amnoncommon feces, homo sapiens, colombia2019-01-09v41 / 124approvedNo
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v41 / 125approvedNo
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v41 / 127approvedNo
131amnoncommon feces, homo sapiens, south korea2017-04-16v41 / 128approvedNo
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v41 / 129approvedNo
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v41 / 129approvedNo
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v41 / 129approvedNo
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v41 / 130approvedNo
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v41 / 131approvedNo
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v41 / 131approvedNo
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v41 / 133approvedNo
246amnoncommon homo sapiens, saliva, italy2017-11-21v41 / 133approvedNo
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v41 / 133approvedNo
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v41 / 133approvedNo
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v41 / 134approvedNo
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v41 / 135approvedNo
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v41 / 136approvedNo
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v41 / 136approvedNo
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 136approvedNo
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v41 / 137approvedNo
10amnoncommon feces, homo sapiens, toronto2016-10-27v41 / 138approvedNo
63amnon high in female compared to male in homo sapiens skin 2017-02-15v41 / 139approvedNo
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v41 / 140approvedNo
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v41 / 141approvedNo
132amnoncommon feces, homo sapiens, united states of america2017-04-16v41 / 145approvedNo
29amnoncommon brassica oleracea, french republic, seed2016-12-05v41 / 146approvedNo
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v41 / 146approvedNo
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v41 / 146approvedNo
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v41 / 147approvedNo
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v41 / 147approvedNo
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v41 / 148approvedNo
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v41 / 152approvedNo
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v41 / 153approvedNo
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v41 / 154approvedNo
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v41 / 155approvedNo
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v41 / 157approvedNo
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v41 / 157approvedNo
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v41 / 158approvedNo
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v31 / 159approvedNo
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v41 / 160approvedNo
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v41 / 161approvedNo
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v41 / 161approvedNo
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v41 / 162approvedNo
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v41 / 162approvedNo
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v41 / 162approvedNo
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v41 / 162approvedNo
919amnon high in 12-month-old human stage compared to 2-month-old human stage in homo sapiens saliva infant australia state of victoria 2022-07-17v41 / 164approvedNo
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v41 / 166approvedNo
961amnon high in 6-year-old human stage compared to 4-year-old human stage in feces homo sapiens child kingdom of denmark zealand 2022-12-20v41 / 166approvedNo
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v41 / 167approvedNo
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v41 / 167approvedNo
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america dentition supragingival plaque supragingival dental plaque no dental caries 2022-07-25v41 / 167approvedNo
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v41 / 169approvedNo
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v41 / 169approvedNo
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v41 / 170approvedNo
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v41 / 170approvedNo
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v41 / 179approvedNo
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v41 / 183approvedNo
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v31 / 184approvedNo
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v41 / 187approvedNo
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v41 / 188approvedNo
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v41 / 189approvedNo
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v41 / 190approvedNo
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v41 / 190approvedNo
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v41 / 193approvedNo
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v41 / 193approvedNo
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v41 / 195approvedNo
963amnon high in age 3 weeks compared to age 1 week in united states of america research facility caecum gallus gallus chicken broiler chicken male organism state of indiana 2022-12-20v41 / 196approvedNo
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v41 / 197approvedNo
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v41 / 197approvedNo
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v31 / 197approvedNo
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v41 / 200approvedNo
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v41 / 201approvedNo
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v41 / 203approvedNo
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v41 / 205approvedNo
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v31 / 205approvedNo
120amnoncommon feces, homo sapiens, brazil2017-04-12v41 / 208approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v41 / 212approvedNo
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v41 / 213approvedNo
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v41 / 213approvedNo
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v41 / 216approvedNo
892amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva 2022-04-07v41 / 216approvedNo
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v41 / 218approvedNo
566amnoncommon feces, homo sapiens, adult, china2019-11-24v41 / 221approvedNo
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v41 / 227approvedNo
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v41 / 232approvedNo
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v41 / 232approvedNo
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v41 / 236approvedNo
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v41 / 239approvedNo
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v41 / 242approvedNo
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v41 / 243approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant nigeria edo state 2022-12-20v41 / 244approvedNo
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v41 / 249approvedNo
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v41 / 253approvedNo
945amnon high in non-smoker compared to smoker cigarette smoking in homo sapiens united states of america oral cavity adult oral wash 2022-11-29v41 / 256approvedNo
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v41 / 262approvedNo
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v41 / 263approvedNo
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn season, cloud)2017-11-22v41 / 267approvedNo
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v41 / 281approvedNo
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v41 / 288approvedNo
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v41 / 296approvedNo
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v41 / 298approvedNo
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v41 / 301approvedNo
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v41 / 306approvedNo
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v41 / 311approvedNo
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v41 / 317approvedNo
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v41 / 321approvedNo
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v41 / 328approvedNo
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v41 / 338approvedNo
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v41 / 345approvedNo
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth (water) 25cm in north america )2017-10-15v41 / 359approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v41 / 363approvedNo
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v41 / 373approvedNo
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v41 / 379approvedNo
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v41 / 381approvedNo
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v41 / 387approvedNo
912amnon high in alive compared to dead in research facility body proper whole body mussel fresh water aquarium dreissena polymorpha zebra mussel 2022-05-27v41 / 398approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in feces homo sapiens infant nigeria edo state 2022-12-20v41 / 407approvedNo
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v41 / 408approvedNo
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v41 / 422approvedNo
642amnon high in gill compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v41 / 434approvedNo
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v41 / 557approvedNo
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v41 / 567approvedNo
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v31 / 583approvedNo
995amnoncommon feces, united states of america, zoological garden, state of ohio, monkey, pongo sp., columbus, orangutan2022-12-27v41 / 613approvedNo
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v41 / 622approvedNo
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v41 / 755approvedNo
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v41 / 836approvedNo
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v41 / 836approvedNo
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v41 / 854approvedNo
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v41 / 1130approvedNo
960amnon high in female adult compared to infant 18-month-old human stage in feces homo sapiens nigeria edo state 2022-12-20v41 / 1392approvedNo
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth (water) 200m, sediment depth 12-35cm2017-04-18v41 / 1659approvedNo
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v41 / 1834approvedNo
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v41 / 2162approvedNo

Problems / suggestions? Please visit the dbBact forum