Search result for sequence:
AACCAGCACCTCAAGTGGTCAGGATGATTATTGGGCCTAAAGCATCCGTAGCCGGCGCTATAAGTTTTCGGTTAAATCTGTACGCTCAACGTACAGGCTGCCGGGAATACTGTAGCGCTAGGGAGTGGGAGAGGTAGACGGTACTCGGTA
common ontology terms
term enrichment score
TermScore
hawaii0.363636
coral reef0.333333
egg0.285714
ocean0.111111
sediment0.095238
research facility0.021858
united states of america0.012308
Fraction of dbbact annotations with this term covered by the query
TermScore
coral reef0.333333
hawaii0.250000
egg0.250000
ocean0.066667
sediment0.055556
research facility0.011111
united states of america0.006211
Fraction of annotations for the query sequences containing the term
TermScore
hawaii0.666667
pearl harbor0.666667
research facility0.666667
hydroides elegans0.666667
tubeworm0.666667
united states of america0.666667
ocean0.333333
sediment0.333333
coral reef0.333333
egg0.333333
tubeworm tube0.333333

Problems / suggestions? Please email info AT dbbact DOT org