Search result for sequence:
AACCAGCACCTCAAGTGGTCAGGATGATTATTGGGCCTAAAGCATCCGTAGCCGGCGCTATAAGTTTTCGGTTAAATCTGTACGCTCAACGTACAGGCTGCCGGGAATACTGTAGCGCTAGGGAGTGGGAGAGGTAGACGGTACTCGGTA
common ontology terms
term enrichment score
TermScore
pearl harbor0.571429
hydroides elegans0.571429
tubeworm0.571429
tubeworm tube0.400000
coral reef0.333333
hawaii0.307692
egg0.250000
ocean0.105263
sediment0.076923
research facility0.020725
united states of america0.011268
Fraction of dbbact annotations with this term covered by the query
TermScore
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
coral reef0.333333
hawaii0.200000
egg0.200000
ocean0.062500
sediment0.043478
research facility0.010526
united states of america0.005682
Fraction of annotations for the query sequences containing the term
TermScore
hawaii0.666667
pearl harbor0.666667
research facility0.666667
hydroides elegans0.666667
tubeworm0.666667
united states of america0.666667
ocean0.333333
sediment0.333333
coral reef0.333333
egg0.333333
tubeworm tube0.333333

Problems / suggestions? Please email info AT dbbact DOT org