Search result for sequence:
AACCAGCACCTCAAGTGGTCAGGATGATTATTGGGCCTAAAGCATCCGTAGCCGGCTCTATAAGTTTTCGGTTAAATCTGTACGCTCAACGTACAGGCTGCCGGGAATACTGCAGAGCTAGGGAGTGGGAGAGGTAGACGGTACTCGGTA
common ontology terms
term enrichment score
TermScore
beach0.571429
hawaii0.363636
pearl harbor0.307692
hydroides elegans0.307692
tubeworm0.307692
sand0.294118
egg0.285714
monterey bay0.266667
LOWER IN sea water0.210526
bobtail squid0.181818
euprymna scolopes0.181818
egg jelly0.181818
LOWER IN shell gland0.181818
tubeworm tube0.181818
san francisco bay0.181818
santa cruz province0.181818
LOWER IN air0.181818
LOWER IN water0.129032
pacific ocean0.108108
state of california0.093023
sea water0.086957
water0.037736
united states of america0.022440
research facility0.020101
Fraction of dbbact annotations with this term covered by the query
TermScore
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
beach0.500000
tubeworm tube0.500000
san francisco bay0.500000
santa cruz province0.500000
LOWER IN air0.500000
hawaii0.400000
egg0.400000
monterey bay0.333333
sand0.200000
LOWER IN sea water0.200000
LOWER IN water0.090909
sea water0.071429
pacific ocean0.058824
state of california0.050000
water0.022727
united states of america0.011364
research facility0.010526
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.888889
state of california0.666667
beach0.666667
pacific ocean0.666667
sand0.555556
hawaii0.333333
egg0.222222
pearl harbor0.222222
research facility0.222222
hydroides elegans0.222222
tubeworm0.222222
monterey bay0.222222
LOWER IN water0.222222
LOWER IN sea water0.222222
bobtail squid0.111111
euprymna scolopes0.111111
egg jelly0.111111
LOWER IN shell gland0.111111
water0.111111
sea water0.111111
tubeworm tube0.111111
san francisco bay0.111111
santa cruz province0.111111
LOWER IN air0.111111

Problems / suggestions? Please email info AT dbbact DOT org