Search result for sequence:
AACCAGCACCTCAAGTGGTCAGGATGATTATTGGGCCTAAAGCATCCGTAGCCGGCTCTGTAAGTTTTCGGTTAAATCTGTACGCTCAACGTACAGGCTGCCGGGAATACTGCAGAGCTAGGGAGTGGGAGAGGTAGACGGTACTCGGTA
common ontology terms
term enrichment score
TermScore
pacific ocean0.556945
ocean water0.439634
saline water0.393443
monterey bay0.376682
water0.341270
ocean0.325472
state of california0.311321
marine sediment0.291013
sea water0.248521
sediment0.226415
beach0.148936
north east pacific ocean0.148936
oil seep0.138614
mediterranean sea0.136364
hawaii0.126316
coral0.115385
depth 100m0.114286
hydrothermal vent0.090909
greece0.090909
marine hydrothermal vent0.090909
volcanic rock0.090909
volcanic crater0.090909
saanich inlet0.090909
pearl harbor0.090909
hydroides elegans0.090909
tubeworm0.090909
surface water0.088235
depth 1000-2000m0.086957
depth 500-1000m0.071006
east china sea0.069767
inactive vent0.069767
depth 200m0.069767
depth 75m0.069767
skeleton0.069767
tissue0.069767
depth 20m0.069767
north america0.069767
depth 300m0.067416
sand0.063158
canada0.062500
depth 80m0.047619
depth 60m0.047619
depth 1500.047619
depth 40m0.047619
depth 30m0.047619
diploastrea heliopora0.047619
galaxea astreata0.047619
depth 5m0.047619
portuguese republic0.047619
bilbao0.047619
estuary0.047619
estuary water0.047619
salinity >20 ppt0.047619
size < 1um0.047619
LOWER IN air0.047619
shore0.047619
carbonate0.047619
lithified carbonate blocks0.047619
hydrate ridge0.047619
low activity methane seep0.047619
nan'ao island0.047619
depth 25cm0.047619
depth 150m0.047619
depth 50-100m0.047619
san francisco bay0.047619
coral reef0.046512
marine water body0.046512
free floating0.045455
state of oregon0.044444
atlantic ocean0.042553
united states of america0.040816
kingdom of spain0.040816
china0.036364
physogyra lichtensteini0.024390
pavona varians0.024390
LOWER IN active vent0.024390
LOWER IN coral reef0.024390
LOWER IN coral0.024390
LOWER IN eunicella labiata0.024390
LOWER IN gorgonian coral0.024390
active vent0.024390
depth 10m0.024390
respiratory airway0.024390
exhaled air condensate0.024390
whale blow0.024390
LOWER IN atlantic ocean0.024390
LOWER IN salinity <5 ppt0.024390
gulf of naples0.024390
mangrove0.024390
avicennia germinans0.024390
rhizophora mangle0.024390
LOWER IN aerosol0.024390
LOWER IN particle bound0.024390
LOWER IN size 1-80um0.024390
other regions0.024390
LOWER IN yushan islands0.024390
LOWER IN depth 200m0.024390
juan de fuca nehalem0.024390
LOWER IN megaptera novaeangliae0.024390
LOWER IN humpback whale0.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
mediterranean sea0.750000
monterey bay0.666667
depth 100m0.666667
depth 500-1000m0.666667
saline water0.571429
pacific ocean0.529412
east china sea0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
inactive vent0.500000
depth 80m0.500000
depth 200m0.500000
depth 60m0.500000
saanich inlet0.500000
depth 1500.500000
depth 75m0.500000
depth 40m0.500000
depth 30m0.500000
physogyra lichtensteini0.500000
skeleton0.500000
diploastrea heliopora0.500000
pavona varians0.500000
tissue0.500000
galaxea astreata0.500000
depth 5m0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
LOWER IN active vent0.500000
depth 20m0.500000
portuguese republic0.500000
LOWER IN coral reef0.500000
LOWER IN coral0.500000
LOWER IN eunicella labiata0.500000
LOWER IN gorgonian coral0.500000
active vent0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
depth 10m0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
LOWER IN atlantic ocean0.500000
LOWER IN salinity <5 ppt0.500000
size < 1um0.500000
gulf of naples0.500000
mangrove0.500000
avicennia germinans0.500000
rhizophora mangle0.500000
beach0.500000
LOWER IN air0.500000
LOWER IN aerosol0.500000
LOWER IN particle bound0.500000
LOWER IN size 1-80um0.500000
other regions0.500000
LOWER IN yushan islands0.500000
LOWER IN depth 200m0.500000
shore0.500000
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
low activity methane seep0.500000
nan'ao island0.500000
depth 25cm0.500000
north east pacific ocean0.500000
depth 150m0.500000
juan de fuca nehalem0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
LOWER IN exhaled air condensate0.500000
depth 500m0.500000
tubeworm tube0.500000
clayoquot slope0.500000
astorya canyon sw wall0.500000
LOWER IN depth 5m0.500000
barkley canyon0.500000
deth 5-100m0.500000
depth 50-100m0.500000
LOWER IN depth 150-500m0.500000
bodega bay0.500000
san francisco bay0.500000
hecceta sw0.500000
santa cruz county0.500000
brackish water0.500000
caspian sea0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
LOWER IN depth 5-50m0.500000
LOWER IN oil seep0.500000
LOWER IN active methane seep0.500000
LOWER IN depth 2000-3000m0.500000
LOWER IN depth 500-1000m0.500000
Fraction of annotations for the query sequences containing the term
TermScore
pacific ocean0.587500
water0.537500
ocean water0.412500
state of california0.412500
saline water0.300000
ocean0.287500
monterey bay0.262500
marine sediment0.212500
sediment0.200000
united states of america0.200000
sea water0.175000
beach0.087500
north east pacific ocean0.087500
oil seep0.087500
mediterranean sea0.075000
coral0.075000
hawaii0.075000
china0.062500
depth 100m0.062500
hydrothermal vent0.050000
greece0.050000
marine hydrothermal vent0.050000
volcanic rock0.050000
volcanic crater0.050000
canada0.050000
saanich inlet0.050000
surface water0.050000
pearl harbor0.050000
research facility0.050000
hydroides elegans0.050000
tubeworm0.050000
depth 1000-2000m0.050000
east china sea0.037500
inactive vent0.037500
depth 200m0.037500
depth 300m0.037500
depth 75m0.037500
skeleton0.037500
tissue0.037500
depth 20m0.037500
north america0.037500
depth 500-1000m0.037500
sand0.037500
coral reef0.025000
depth 80m0.025000
depth 60m0.025000
depth 1500.025000
depth 40m0.025000
depth 30m0.025000
diploastrea heliopora0.025000
galaxea astreata0.025000
depth 5m0.025000
atlantic ocean0.025000
portuguese republic0.025000
marine water body0.025000
kingdom of spain0.025000
bilbao0.025000
estuary0.025000
estuary water0.025000
salinity >20 ppt0.025000
free floating0.025000
size < 1um0.025000
LOWER IN air0.025000
shore0.025000
carbonate0.025000
lithified carbonate blocks0.025000
hydrate ridge0.025000
state of oregon0.025000
low activity methane seep0.025000
nan'ao island0.025000
depth 25cm0.025000
depth 150m0.025000
depth 50-100m0.025000
san francisco bay0.025000
physogyra lichtensteini0.012500
pavona varians0.012500
LOWER IN mucus0.012500
adult0.012500
larval stage0.012500
depth 2000-3000m0.012500
late time points0.012500
depth 0m0.012500
LOWER IN early time points0.012500
LOWER IN active vent0.012500
LOWER IN coral reef0.012500
LOWER IN coral0.012500
LOWER IN eunicella labiata0.012500
LOWER IN gorgonian coral0.012500
active vent0.012500
depth 10m0.012500
megaptera novaeangliae0.012500
humpback whale0.012500
respiratory airway0.012500
exhaled air condensate0.012500
whale blow0.012500
LOWER IN atlantic ocean0.012500
LOWER IN fresh water0.012500
LOWER IN salinity <5 ppt0.012500
egg0.012500
italy0.012500
Exp. ID User ID Description Date Sequences
223amnonhighfreq sediment, marine sediment, china, ocean, east china sea2017-10-261 / 8
418amnonhighfreq ocean, sediment, coral reef2018-12-021 / 10
362amnonhighfreq hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-291 / 12
473amnonhighfreq water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 80m2019-01-161 / 12
473amnonhighfreq water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 100m2019-01-161 / 13
473amnonhighfreq water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 200m2019-01-161 / 14
473amnonhighfreq water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 60m2019-01-161 / 15
496amnonhighfreq water, ocean water, canada, saanich inlet, pacific ocean, depth 100m2019-03-031 / 15
317amnonhighfreq water, ocean water, united states of america, state of california, pacific ocean, depth 300m, depth 150, depth 75m2018-04-151 / 16
473amnonhighfreq water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 40m2019-01-161 / 16
473amnonhighfreq water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 30m2019-01-161 / 17
418amnoncommon coral, ocean, physogyra lichtensteini, skeleton2018-12-021 / 19
418amnoncommon coral, ocean, diploastrea heliopora, skeleton2018-12-021 / 26
418amnoncommon coral, ocean, pavona varians, tissue2018-12-021 / 29
418amnoncommon coral, ocean, galaxea astreata, skeleton2018-12-021 / 42
418amnoncommon coral, ocean, galaxea astreata, tissue2018-12-021 / 44
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-021 / 44
317amnoncommon water, ocean water, united states of america, state of california, pacific ocean, surface water, depth 5m2018-04-151 / 62
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-131 / 80
483amnoncommon larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-131 / 100
317amnoncommon water, ocean water, united states of america, state of california, pacific ocean, depth 300m, depth 150, depth 75m2018-04-151 / 101
500amnonincreases when incubating water sample from depth 2100m at depth 0m for one year ( high in late time points depth 0m compared to early time points in water ocean water mediterranean sea depth 2000-3000m )2019-03-051 / 114
362amnon high in inactive vent compared to active vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-291 / 129
280amnon high in marine water body sea water saline water compared to coral reef coral eunicella labiata gorgonian coral in atlantic ocean depth 20m portuguese republic 2018-01-251 / 132
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-291 / 150
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, saline water, salinity >20 ppt2019-03-201 / 158
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 10m2019-01-161 / 213
418amnoncommon ocean, sediment, coral reef2018-12-021 / 216
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-151 / 219
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 5m2019-01-161 / 220
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-201 / 223
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 20m2019-01-161 / 225
505amnoncommon water, ocean water, pacific ocean, state of california, surface water, free floating, size < 1um2019-03-141 / 225
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-131 / 243
485amnoncommon water, ocean water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast2019-02-191 / 244
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-251 / 259
282amnoncommon soil, mangrove biome, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-251 / 259
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america state of california beach pacific ocean )2018-03-121 / 260
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water ocean water pacific ocean state of california surface water 2019-03-141 / 283
496amnoncommon water, ocean water, canada, saanich inlet, pacific ocean, depth 200m2019-03-031 / 287
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 30m2019-01-161 / 293
223amnon high in other regions compared to yushan islands in sediment marine sediment china ocean east china sea 2017-10-261 / 302
496amnon high in depth 100m compared to depth 200m in water ocean water canada saanich inlet pacific ocean 2019-03-031 / 310
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 40m2019-01-161 / 340
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-121 / 345
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, low activity methane seep2019-02-191 / 371
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 60m2019-01-161 / 390
504amnoncommon china, nan'ao island, sediment, marine sediment2019-03-141 / 437
209amnoncommon sea water, ocean, north america, depth 25cm2017-10-151 / 445
504amnoncommon china, nan'ao island, water, ocean water, sea water2019-03-141 / 452
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 80m2019-01-161 / 454
496amnoncommon water, ocean water, canada, saanich inlet, pacific ocean, depth 100m2019-03-031 / 469
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-291 / 480
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 100m2019-01-161 / 486
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 200m2019-01-161 / 492
472amnoncommon ocean, sediment, marine sediment, pacific ocean, north east pacific ocean, oil seep, depth 150m, juan de fuca nehalem2019-01-161 / 535
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-151 / 560
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 500m2019-01-161 / 587
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-121 / 667
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 1000-2000m, clayoquot slope2019-01-161 / 725
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 150-500m, astorya canyon sw wall2019-01-161 / 758
317amnonhigher in depth>75m compared to depth >5m in ocean water ( high in depth 300m depth 75m depth 150m compared to surface water depth 5m depth 0m in water ocean water united states of america state of california pacific ocean )2018-04-151 / 889
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 500-1000m, barkley canyon2019-01-161 / 990
473amnon high in winter compared to summer in water saline water ocean water pacific ocean state of california monterey bay deth 5-100m 2019-01-161 / 1006
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-121 / 1038
473amnon high in depth 50-100m compared to depth 150-500m in water saline water ocean water pacific ocean state of california monterey bay 2019-01-161 / 1072
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-121 / 1151
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-071 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-121 / 1166
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth 1000-2000m2019-01-161 / 1275
223amnoncommon china, ocean, sediment, east china sea, marine sediment2017-10-261 / 1311
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-121 / 1425
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-181 / 1549
473amnon high in depth 50-100m compared to depth 5-50m in water saline water ocean water pacific ocean state of california monterey bay 2019-01-161 / 1656
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-191 / 1791
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-161 / 2593
472amnon high in depth 1000-2000m compared to depth 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-161 / 3000

Problems / suggestions? Please email info AT dbbact DOT org