Search result for sequence:
AACCAGCACCTCAAGTGGTCAGGATGATTATTGGGCCTAAAGCATCCGTAGCCTGCTTTGTAAGTTTTCGGTTAAATCCATACGCTCAACGTATGGGCTGCCGGGAATACTGCAAAGCTAGGGAGTGGGAGAGGTAGACGGTACTCGGTA
common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 3
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 4
571amnondominant china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
223amnondominant sediment, marine sediment, ocean, east china sea, china2017-10-26v4No1 / 8
142amnonhigh freq. in cruise 1 (western antarctica) (dominant marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-19v4No1 / 10
223amnon high in sanmen bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 110
545amnoncommon atlantic ocean, ocean, biofilm, debris, depth 200-2000 m2019-08-04v4No1 / 227
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, low activity methane seep2019-02-19v4No1 / 371
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 1000-2000m, clayoquot slope2019-01-16v4No1 / 725
142amnoncommon in cruise 1 (western antarctica) (common marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-19v4No1 / 756
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-19v4No1 / 1791
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
472amnon high in depth 1000-2000m compared to depth 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000

Problems / suggestions? Please email info AT dbbact DOT org