Search result for sequence:
AACGAACGCTATCGGTATGCTTAACACATGCAAGTCGAACGGACTAATTGGGGCTTGCTCCAATTAGTTAGTGGCAGACGGGTGAGTAACATGTGGGAATCTACCCATCAGTACGGAATAACTTTTAGAAATAAAAGCTAATACCGTATA
common ontology terms
term enrichment score
TermScore
tick0.480000
ixodes tasmani0.363636
ixodes australiensis0.363636
ixodes antechini0.363636
whole body0.250000
wombat tick0.222222
bothriocroton auruginans0.222222
body proper0.200000
australia0.100000
Fraction of dbbact annotations with this term covered by the query
TermScore
ixodes tasmani0.500000
ixodes australiensis0.500000
wombat tick0.500000
bothriocroton auruginans0.500000
ixodes antechini0.500000
tick0.333333
whole body0.142857
body proper0.111111
australia0.052632
Fraction of annotations for the query sequences containing the term
TermScore
body proper1.000000
whole body1.000000
australia1.000000
tick0.857143
ixodes tasmani0.285714
ixodes australiensis0.285714
ixodes antechini0.285714
wombat tick0.142857
bothriocroton auruginans0.142857

Problems / suggestions? Please email info AT dbbact DOT org