Search result for sequence:
AACGGAGGGGACAAGTGTTATTCGGAATGACTGGGCGTAAAGGGTCCGCAGGCGGGCTTATAAGTTCAAAGAACCATCCCAAAGAACTCCTTTGGATTATCTTTGATAAGTATAGGTCTTGAGTCAGATAGAGGAAAGTGGAATGTCATG
common ontology terms
term enrichment score
TermScore
siganidae0.461538
rabbitfish0.461538
guinea0.363636
depth 3m0.363636
biofilm material0.363636
metal0.363636
outer biofilm0.363636
midgut0.235294
biofilm0.235294
polymetallic nodule0.222222
depth 4000m0.200000
LOWER IN marine sediment0.200000
hindgut0.181818
hawaii0.181818
sea water0.129032
australia0.115385
pacific ocean0.095238
water0.054795
research facility0.020619
united states of america0.011905
Fraction of dbbact annotations with this term covered by the query
TermScore
siganidae0.500000
rabbitfish0.500000
guinea0.500000
depth 3m0.500000
biofilm material0.500000
metal0.500000
outer biofilm0.500000
polymetallic nodule0.500000
depth 4000m0.333333
LOWER IN marine sediment0.333333
hindgut0.250000
hawaii0.250000
midgut0.200000
biofilm0.200000
sea water0.083333
pacific ocean0.071429
australia0.066667
water0.030303
research facility0.011111
united states of america0.006211
Fraction of annotations for the query sequences containing the term
TermScore
siganidae0.428571
rabbitfish0.428571
australia0.428571
midgut0.285714
water0.285714
sea water0.285714
guinea0.285714
depth 3m0.285714
biofilm0.285714
biofilm material0.285714
metal0.285714
outer biofilm0.285714
hindgut0.142857
hawaii0.142857
pearl harbor0.142857
research facility0.142857
hydroides elegans0.142857
tubeworm0.142857
united states of america0.142857
tubeworm tube0.142857
pacific ocean0.142857
depth 4000m0.142857
polymetallic nodule0.142857
LOWER IN marine sediment0.142857

Problems / suggestions? Please email info AT dbbact DOT org