Search result for sequence:
AACGTAGGAGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGGGCAGGCGGTGACTTAAGTCATGCGTGAAAGCTCCTGGCTCAACTGGGAGAGGTCGTGTGAAACTGGGTCGCTAGAGGTAAGTAGAGGCAGACGGAATTCCGGG
common ontology terms
term enrichment score
TermScore
pearl harbor0.666667
hydroides elegans0.666667
tubeworm0.666667
tubeworm tube0.666667
hawaii0.333333
research facility0.020833
united states of america0.011299
Fraction of dbbact annotations with this term covered by the query
TermScore
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
hawaii0.200000
research facility0.010526
united states of america0.005682
Fraction of annotations for the query sequences containing the term
TermScore
hawaii1.000000
pearl harbor1.000000
research facility1.000000
hydroides elegans1.000000
tubeworm1.000000
united states of america1.000000
tubeworm tube1.000000

Problems / suggestions? Please email info AT dbbact DOT org