Search result for sequence:
AACGTAGGAGTCAAGCGTTATCCGAATTTACTGGGCGTAAAGCGCGTGCAGGCGGTTTGGTAAGTTGGATGTGAAAGCTCCCGGCTCAACTGGGAGAGGACGTTCAATACTGCCAGGCTAGAGGGCGACAGAGGGAGGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
danzhou xinyinggang nature reserve0.500000
mangrove biome0.500000
mangrove swamp0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
kandelia candel0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
hainan autonomous prefecture0.333333
spartina alterniflora0.333333
mangrove0.333333
guangdong province0.333333
depth 0-20cm0.200000
zhejiang province0.200000
marine sediment0.071429
rhizosphere0.037037
china0.020833
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
mangrove swamp1.000000
china1.000000
mangrove biome0.875000
depth 0-20cm0.875000
marine sediment0.875000
soil0.875000
hainan autonomous prefecture0.500000
mangrove0.500000
kandelia candel0.375000
danzhou xinyinggang nature reserve0.250000
spartina alterniflora0.250000
dongzhaigang national nature reserve0.250000
leizhou nature reserve0.250000
guangdong province0.250000
rhizophora stylosa0.125000
mudflat0.125000
futian national nature reserve0.125000
zhejiang province0.125000
rhizosphere0.125000
Exp. ID User ID Description Date Region Flag Sequences
571amnoncommon danzhou xinyinggang nature reserve, hainan autonomous prefecture, spartina alterniflora, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1169
571amnoncommon rhizophora stylosa, mangrove, danzhou xinyinggang nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1210
571amnoncommon dongzhaigang national nature reserve, hainan autonomous prefecture, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1351
571amnoncommon mudflat, dongzhaigang national nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1422
571amnoncommon kandelia candel, mangrove, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1435
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon kandelia candel, mangrove, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1523

Problems / suggestions? Please email info AT dbbact DOT org