Search result for sequence:
AACGTAGGATCCGAGCGTTATCCGAATTTACTGGGCGTAAAGCGCGTGCAGGCGGTTTGGTAAGTTGGATGTGAAAGCTCCCGGCTCAACTGGGAGAGGTCGTTCAATACTGCCAGACTCGAGGATGGTAGAGGGAGGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
east china sea0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
shenzhen futian national nature reserve0.500000
ximendao national marine reserve0.500000
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
zhejiang province0.166667
marine sediment0.142857
depth 0-20cm0.142857
ocean0.062500
sediment0.043478
rhizosphere0.030303
china0.028302
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
mangrove swamp0.933333
marine sediment0.933333
soil0.866667
depth 0-20cm0.866667
mangrove0.400000
kandelia candel0.333333
zhejiang province0.333333
spartina alterniflora0.266667
hainan autonomous prefecture0.266667
guangdong province0.266667
mudflat0.200000
futian national nature reserve0.200000
danzhou xinyinggang nature reserve0.133333
dongzhaigang national nature reserve0.133333
leizhou nature reserve0.133333
shenzhen futian national nature reserve0.133333
ximendao national marine reserve0.133333
rhizophora stylosa0.066667
ocean0.066667
sediment0.066667
east china sea0.066667
rhizosphere0.066667
Exp. ID User ID Description Date Region Flag Sequences
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org