Search result for sequence:
AACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGCTTAGTAGGTTGGACGTGAAAGCTCCTGGCTCAACTGGGAGAGGCCGTTCAATACCGCTAGGCTCGAGGGCGGAAGAGGGGAGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
nan'ao island0.500000
east china sea0.500000
yushan islands0.500000
LOWER IN other regions0.500000
rhizophora stylosa0.500000
danzhou xinyinggang nature reserve0.500000
mangrove biome0.500000
mangrove swamp0.500000
dongzhaigang national nature reserve0.500000
kandelia candel0.500000
mudflat0.500000
leizhou nature reserve0.500000
beach0.500000
futian national nature reserve0.500000
san francisco bay0.500000
santa cruz province0.500000
bodega bay0.500000
LOWER IN air0.500000
north east pacific ocean0.500000
depth 1000-2000m0.500000
LOWER IN depth 2000-3000m0.500000
marine sediment0.357143
mangrove0.333333
hainan autonomous prefecture0.333333
spartina alterniflora0.333333
guangdong province0.333333
zostera marina0.333333
marine eelgrass0.333333
oil seep0.333333
LOWER IN sea water0.285714
depth 0-20cm0.200000
sand0.200000
zhejiang province0.200000
ocean0.187500
LOWER IN water0.181818
sediment0.173913
pacific ocean0.117647
LOWER IN root0.111111
state of california0.105263
china0.041667
rhizosphere0.037037
soil0.018519
united states of america0.005208
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.705882
china0.588235
sediment0.411765
mangrove swamp0.352941
state of california0.352941
ocean0.294118
mangrove biome0.294118
depth 0-20cm0.294118
soil0.294118
pacific ocean0.294118
united states of america0.235294
beach0.235294
sand0.235294
LOWER IN water0.176471
LOWER IN sea water0.176471
hainan autonomous prefecture0.176471
nan'ao island0.117647
east china sea0.117647
mangrove0.117647
dongzhaigang national nature reserve0.117647
spartina alterniflora0.117647
bodega bay0.117647
zostera marina0.117647
marine eelgrass0.117647
yushan islands0.058824
LOWER IN other regions0.058824
rhizophora stylosa0.058824
danzhou xinyinggang nature reserve0.058824
kandelia candel0.058824
mudflat0.058824
leizhou nature reserve0.058824
guangdong province0.058824
rhizosphere0.058824
futian national nature reserve0.058824
zhejiang province0.058824
san francisco bay0.058824
santa cruz province0.058824
LOWER IN air0.058824
oil seep0.058824
north east pacific ocean0.058824
depth 1000-2000m0.058824
LOWER IN depth 2000-3000m0.058824
LOWER IN root0.058824
Exp. ID User ID Description Date Region Flag Sequences
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
571amnoncommon rhizophora stylosa, mangrove, danzhou xinyinggang nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1210
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon dongzhaigang national nature reserve, hainan autonomous prefecture, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1351
571amnoncommon mudflat, dongzhaigang national nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1422
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
571amnoncommon futian national nature reserve, spartina alterniflora, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1747
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070
472amnon high in depth 1000-2000m compared to depth 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745

Problems / suggestions? Please email info AT dbbact DOT org