Search result for sequence:
AACGTAGGGGGCCAGCGTTGCTCGGAATTACTGGGCGTAAAGGGTCCGTAGGCGGTGTGGCAAGTCGGAAGTGAAATCTCTGGGCTTAACTCAGAGGCTGCTTCCGAAACTGCTGTGCTAGAGTGCGAGAGAGGCGAGTGGAATTGCGGG
common ontology terms
term enrichment score
TermScore
minas gerais state0.533333
campos rupestres0.533333
vellozia epidendroides0.363636
barbacenia macrantha0.363636
topsoil0.250000
forest ecosystem0.250000
central park0.222222
ph<5.50.222222
LOWER IN ph&gt;5.50.222222
moist tropical forest0.222222
ph<4.50.222222
LOWER IN ph&gt;4.50.222222
subtropical broadleaf forest biome0.222222
woodland area0.222222
park0.200000
depth (soil) 0-10cm0.200000
urban biome0.181818
root endosphere0.181818
new york city0.142857
guangdong province0.125000
brazil0.096386
LOWER IN root0.090909
root0.090909
soil0.055556
rhizosphere0.040541
ph0.032787
china0.010417
Fraction of dbbact annotations with this term covered by the query
TermScore
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
subtropical broadleaf forest biome0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
park0.333333
urban biome0.250000
root endosphere0.250000
topsoil0.222222
forest ecosystem0.222222
woodland area0.181818
depth (soil) 0-10cm0.153846
new york city0.142857
guangdong province0.111111
LOWER IN root0.066667
root0.066667
brazil0.052632
soil0.029703
rhizosphere0.021277
ph0.018519
china0.005405
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state0.571429
campos rupestres0.571429
brazil0.571429
soil0.428571
rhizosphere0.428571
topsoil0.285714
depth (soil) 0-10cm0.285714
woodland area0.285714
forest ecosystem0.285714
vellozia epidendroides0.285714
barbacenia macrantha0.285714
urban biome0.142857
park0.142857
new york city0.142857
central park0.142857
ph0.142857
ph<5.50.142857
LOWER IN ph&gt;5.50.142857
moist tropical forest0.142857
ph<4.50.142857
LOWER IN ph&gt;4.50.142857
guangdong province0.142857
subtropical broadleaf forest biome0.142857
china0.142857
LOWER IN root0.142857
root endosphere0.142857
root0.142857

Problems / suggestions? Please email info AT dbbact DOT org