Search result for sequence:
AACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.653890
feces0.593282
adult0.427712
united states of america0.248270
control0.180836
child0.175488
china0.150893
city0.134969
zoological garden0.121148
rural community0.119107
pig0.099573
sus scrofa0.099573
kingdom of spain0.094340
obsolete_juvenile stage0.088328
male0.077670
female0.074134
india0.073974
infant0.062500
colombia0.061381
farm0.059172
caecum0.055556
pregnancy0.053691
msm0.048151
homosexual0.048151
biopsy0.047863
age 5-13 years0.047863
msw0.047297
heterosexual0.047297
sweden0.044199
nigeria0.041237
LOWER IN crohn's disease0.041237
russia0.040404
hiv infection0.039216
italy0.038095
skin0.037209
gorilla gorilla0.034692
biopsy site0.034642
small village0.034642
gay0.034642
hunter gatherer0.034642
LOWER IN ulcerative colitis0.034394
state of michigan0.034394
taiwan0.034247
taipei city0.034247
chuquisaca department0.034247
right colon0.033956
state of tennessee0.033956
germany0.033898
monkey0.033860
age0.033223
bolivia0.033113
river0.033113
united kingdom0.032841
age 2-4 years0.027586
left colon0.027586
kebbi state0.027586
age 10-15 years0.027586
age 130.027586
himalayas0.027586
como zoo0.027586
pan troglodytes0.027586
chimpanzee0.027586
south korea0.027397
water0.027372
high bmi0.027335
jiangxi province0.027211
age < 3 years0.027211
nepal0.027211
rectum0.027088
state of colorado0.027027
juvenile organism0.026846
state of minnesota0.026144
fresh water0.025000
israel0.023952
parkinson's disease0.021053
metabolic syndrome0.020942
tibet autonomous region0.020942
tonsil0.020942
amerindian0.020942
venezuela0.020942
papio anubis0.020942
LOWER IN age < 1 year0.020906
weaned0.020833
age 4-7 weeks0.020833
corn and soybean diet0.020833
bangladesh0.020833
low anterior resection0.020833
el salvador0.020833
glasgow0.020833
new delhi0.020833
cameroon0.020833
age 50-60 years0.020833
nanning city prefecture0.020833
cecal content0.020833
wastewater treatment plant0.020833
LOWER IN duodenum0.020690
obesity0.020619
africa0.020619
thailand0.020619
french republic0.020513
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum1.333333
parkinson's disease1.000000
rural community0.888889
colombia0.800000
msm0.800000
homosexual0.800000
gorilla gorilla0.800000
pig0.777778
sus scrofa0.777778
biopsy site0.750000
small village0.750000
gay0.750000
hunter gatherer0.750000
india0.714286
nigeria0.666667
biopsy0.666667
metabolic syndrome0.666667
age 5-13 years0.666667
age > 1 year0.666667
medellin metropolitan area0.666667
tibet autonomous region0.666667
state of oklahoma0.666667
LOWER IN crohn's disease0.666667
tonsil0.666667
amerindian0.666667
venezuela0.666667
papio anubis0.666667
olive baboon0.666667
LOWER IN age < 1 year0.600000
zoological garden0.600000
LOWER IN ulcerative colitis0.571429
state of michigan0.571429
homo sapiens0.550562
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN anorexia nervosa0.500000
bangladesh diet0.500000
city0.500000
cron diet0.500000
age 2-4 years0.500000
pregnancy0.500000
bangladesh0.500000
left colon0.500000
msw0.500000
heterosexual0.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
rem sleep behavior disorder0.500000
kebbi state0.500000
age 10-15 years0.500000
toronto0.500000
el salvador0.500000
glasgow0.500000
age 130.500000
spondyloarthritis0.500000
spondylitis0.500000
non c. diff diarrhea0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
metabolic syndrome x0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
lima0.500000
shantytown0.500000
third trimester0.500000
mild0.500000
LOWER IN severe0.500000
quito0.500000
endospore enriched fraction0.500000
lysis0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN premature birth0.500000
gallbladder0.500000
bile0.500000
sigmoid colon0.500000
children0.500000
new delhi0.500000
sudan0.500000
bihar state0.500000
daycare0.500000
age 1-5 years0.500000
gout0.500000
stroke0.500000
salmonella gastroenteritis0.500000
LOWER IN kingdom of spain0.500000
rheumatoid arthritis0.500000
schizophrenia0.500000
athlete0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
jordan0.500000
osteoarthritis0.500000
yaounde0.500000
cameroon0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.851064
homo sapiens0.804965
adult0.386525
united states of america0.301418
control0.159574
china0.134752
child0.109929
city0.078014
zoological garden0.067376
rural community0.063830
pig0.053191
sus scrofa0.053191
kingdom of spain0.053191
obsolete_juvenile stage0.049645
female0.046099
male0.042553
india0.039007
farm0.035461
infant0.035461
colombia0.031915
pregnancy0.028369
caecum0.028369
sweden0.028369
biopsy0.024823
msw0.024823
heterosexual0.024823
age 5-13 years0.024823
msm0.024823
homosexual0.024823
nigeria0.021277
germany0.021277
italy0.021277
russia0.021277
hiv infection0.021277
LOWER IN crohn's disease0.021277
skin0.021277
right colon0.017730
united kingdom0.017730
biopsy site0.017730
taiwan0.017730
taipei city0.017730
small village0.017730
LOWER IN ulcerative colitis0.017730
age0.017730
gay0.017730
state of michigan0.017730
bolivia0.017730
chuquisaca department0.017730
hunter gatherer0.017730
state of tennessee0.017730
gorilla gorilla0.017730
monkey0.017730
water0.017730
river0.017730
jiangxi province0.014184
research facility0.014184
high bmi0.014184
age 2-4 years0.014184
left colon0.014184
state of colorado0.014184
kebbi state0.014184
age 10-15 years0.014184
age 130.014184
juvenile organism0.014184
age < 3 years0.014184
israel0.014184
rectum0.014184
south korea0.014184
nepal0.014184
himalayas0.014184
state of minnesota0.014184
como zoo0.014184
fresh water0.014184
pan troglodytes0.014184
chimpanzee0.014184
weaned0.010638
age 4-7 weeks0.010638
corn and soybean diet0.010638
obesity0.010638
parkinson's disease0.010638
bangladesh0.010638
belgium0.010638
low anterior resection0.010638
zhejiang province0.010638
el salvador0.010638
glasgow0.010638
french republic0.010638
australia0.010638
metabolic syndrome0.010638
commonwealth of pennsylvania0.010638
LOWER IN control0.010638
LOWER IN age < 1 year0.010638
colon0.010638
new delhi0.010638
tibet autonomous region0.010638
kingdom of norway0.010638
cameroon0.010638
africa0.010638
age 50-60 years0.010638
nanning city prefecture0.010638
Exp. ID User ID Description Date Region Flag Sequences
521amnonhigh freq. in weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
2amnon high in control compared to anorexia nervosa in homo sapiens feces 2016-10-05v4No1 / 11
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
607amnondominant germany, homo sapiens, feces, control2020-04-19v4No1 / 17
36amnondominant homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
293amnondominant homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
564amnondominant homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 18
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 18
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
256amnondominant sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
449amnondominant homo sapiens, feces, colombia2019-01-09v4No1 / 19
574amnondominant feces, homo sapiens, russia, adult2020-01-05v3No1 / 19
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
409amnondominant homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
564amnondominant homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 20
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 20
247amnondominant homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 21
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 21
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 21
293amnondominant homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
509amnondominant feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
10amnondominant homo sapiens, feces, toronto2016-10-27v4No1 / 23
53amnondominant homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnondominant homo sapiens, feces, united states of america2017-04-16v4No1 / 23
197amnondominant feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
509amnondominant feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
53amnondominant lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 27
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
319amnondominant homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 28
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, autistic disorder2019-11-18v3No1 / 42
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 47
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
564amnoncommon homo sapiens, child, age 2-4 years, italy, feces, control2019-11-18v3No1 / 50
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
568amnon high in viet nam compared to thailand in gallus gallus chicken feces broiler chicken 2019-12-08v3No1 / 119
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 185
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, spring, china)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org