Search result for sequence:
AACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.636469
feces0.535707
adult0.428902
united states of america0.260466
child0.172043
control0.155440
city0.152381
obsolete_juvenile stage0.135189
china0.108978
rural community0.106289
sus scrofa0.086393
pig0.086393
india0.072398
zoological garden0.071964
kingdom of spain0.069869
female0.067517
colombia0.063444
infant0.058212
LOWER IN crohn's disease0.055046
monkey0.053333
state of colorado0.052174
age0.051769
united kingdom0.050847
age 130.045662
taipei city0.045662
taiwan0.045662
juvenile organism0.043668
river0.043668
state of tennessee0.042735
water0.040134
state of california0.038986
farm0.037879
metabolic syndrome0.037209
heterosexual0.037209
msw0.037209
LOWER IN ulcerative colitis0.037037
himalayas0.036866
chuquisaca department0.036866
age 5-13 years0.036866
jiangxi province0.036199
kingdom of denmark0.036199
nepal0.036199
finland0.035874
bolivia0.035556
fresh water0.032922
hunter gatherer0.028169
small village0.028169
state of oklahoma0.028103
nigeria0.028103
corn and soybean diet0.027907
age 4-7 weeks0.027907
weaned0.027907
low anterior resection0.027907
toronto0.027907
glasgow0.027907
denver0.027907
commonwealth of pennsylvania0.027907
lima0.027907
shantytown0.027907
zambia0.027907
new delhi0.027907
left colon0.027907
wastewater treatment plant0.027907
state of michigan0.027778
biopsy0.027714
right colon0.027714
french republic0.027523
high bmi0.027149
south korea0.027149
duodenum0.027149
kingdom of norway0.027149
belgium0.026432
caecum0.024948
LOWER IN control0.024540
homosexual0.018868
gay0.018868
msm0.018868
amerindian0.018868
venezuela0.018868
gorilla gorilla0.018868
azerbaijan0.018779
pan troglodytes0.018779
chimpanzee0.018779
cron diet0.018779
age<17 years0.018779
spondylitis0.018779
spondyloarthritis0.018779
metabolic syndrome x0.018779
jordan0.018779
papio kindae0.018779
kinda baboon0.018779
bile0.018779
gallbladder0.018779
bangladesh0.018779
africa0.018779
nanchang city prefecture0.018779
thailand0.018779
LOWER IN age one month0.018779
oslo0.018779
age 30-400.018779
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
small village0.750000
rural community0.714286
state of oklahoma0.666667
metabolic syndrome0.666667
india0.666667
heterosexual0.666667
msw0.666667
nigeria0.666667
homosexual0.666667
gay0.666667
msm0.666667
LOWER IN crohn's disease0.666667
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
zoological garden0.600000
colombia0.600000
LOWER IN ulcerative colitis0.571429
homo sapiens0.513333
azerbaijan0.500000
LOWER IN type i diabetes mellitus0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
weaned0.500000
pan troglodytes0.500000
chimpanzee0.500000
cron diet0.500000
age 130.500000
columbia0.500000
normal stool0.500000
LOWER IN hard stool0.500000
low anterior resection0.500000
taipei city0.500000
taiwan0.500000
age<17 years0.500000
toronto0.500000
glasgow0.500000
spondylitis0.500000
spondyloarthritis0.500000
denver0.500000
metabolic syndrome x0.500000
commonwealth of pennsylvania0.500000
lima0.500000
shantytown0.500000
jordan0.500000
endospore enriched fraction0.500000
lysis0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN low human contact0.500000
LOWER IN premature birth0.500000
age 30-50 years0.500000
LOWER IN age 50-80 years0.500000
bile0.500000
gallbladder0.500000
new delhi0.500000
sudan0.500000
bangladesh0.500000
salmonella gastroenteritis0.500000
schizophrenia0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
africa0.500000
madagascar0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
raute0.500000
age 17-290.500000
age 200.500000
LOWER IN egypt0.500000
raji0.500000
nanchang city prefecture0.500000
thailand0.500000
hmong0.500000
chepang0.500000
LOWER IN inflammatory bowel disease0.500000
mild0.500000
LOWER IN severe0.500000
age 6-10 weeks0.500000
chuquisaca department0.500000
age 5-13 years0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
left colon0.500000
irritable bowel syndrome0.500000
LOWER IN irritable bowel syndrome0.500000
LOWER IN age one month0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
LOWER IN india0.500000
kebbi state0.500000
age 10-15 years0.500000
schistosomiasis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.856459
homo sapiens0.837321
adult0.392344
united states of america0.358852
control0.143541
child0.105263
china0.100478
city0.090909
obsolete_juvenile stage0.081340
rural community0.057416
sus scrofa0.047847
pig0.047847
female0.043062
zoological garden0.038278
india0.038278
kingdom of spain0.038278
colombia0.033493
infant0.033493
united kingdom0.028708
state of colorado0.028708
monkey0.028708
age0.028708
LOWER IN crohn's disease0.028708
water0.028708
farm0.023923
state of tennessee0.023923
age 130.023923
juvenile organism0.023923
taipei city0.023923
taiwan0.023923
state of california0.023923
river0.023923
jiangxi province0.019139
finland0.019139
kingdom of denmark0.019139
metabolic syndrome0.019139
heterosexual0.019139
msw0.019139
LOWER IN control0.019139
nepal0.019139
himalayas0.019139
LOWER IN ulcerative colitis0.019139
chuquisaca department0.019139
bolivia0.019139
age 5-13 years0.019139
fresh water0.019139
corn and soybean diet0.014354
age 4-7 weeks0.014354
weaned0.014354
state of oklahoma0.014354
high bmi0.014354
belgium0.014354
low anterior resection0.014354
toronto0.014354
glasgow0.014354
french republic0.014354
denver0.014354
commonwealth of pennsylvania0.014354
lima0.014354
shantytown0.014354
south korea0.014354
zambia0.014354
new delhi0.014354
nigeria0.014354
state of michigan0.014354
biopsy0.014354
right colon0.014354
left colon0.014354
duodenum0.014354
hunter gatherer0.014354
kingdom of norway0.014354
small village0.014354
research facility0.014354
wastewater treatment plant0.014354
caecum0.014354
azerbaijan0.009569
pan troglodytes0.009569
chimpanzee0.009569
commonwealth of virginia0.009569
sichuan province0.009569
cron diet0.009569
caloric restriction diet0.009569
state of ohio0.009569
italy0.009569
obesity0.009569
brazil0.009569
american diet0.009569
age<17 years0.009569
atlanta0.009569
spondylitis0.009569
spondyloarthritis0.009569
metabolic syndrome x0.009569
state of texas0.009569
jordan0.009569
papio kindae0.009569
wild0.009569
kinda baboon0.009569
bile0.009569
gallbladder0.009569
bangladesh0.009569
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 2
521amnonhigh freq. in weaned pigs (highfreq corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 9
276amnonhighfreq feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
399amnonhighfreq pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (highfreq homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
36amnonhighfreq homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
293amnonhighfreq homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
477amnonhighfreq homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
516amnonhighfreq adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 19
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
247amnonhighfreq homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (highfreq low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 21
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (highfreq homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
529amnonhighfreq control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 27
319amnonhighfreq homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in homo sapiens feces south korea )2017-04-16v4No1 / 39
526amnoncommon in bile of healthy controls (common control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 39
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
529amnoncommon control, adult, taipei city, taiwan, feces, homo sapiens2019-07-18v3No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in adult taipei city taiwan feces homo sapiens )2019-07-18v3No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
273amnon high in age age 1 week compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common suckling, age 2-4 weeks, preweaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common low anterior resection, adult, taipei city, taiwan, feces, homo sapiens)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-26v3No1 / 214
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig united kingdom gastrointestinal system )2017-11-26v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, china, water, spring)2017-07-12v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common corn and soybean diet, age 4-7 weeks, weaned, jiangxi province, farm, china, feces, sus scrofa, pig)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common china, wastewater treatment plant, effluent, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in corn and soybean diet age 4-7 weeks weaned compared to age 2-4 weeks suckling preweaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org