Search result for sequence:
AACTTAAGGGCTAGTCTTATAGGCAAAAGCGTAAAGGGTGTGATAGGCCGCCTTATTTAAGAGAGTAAATGGAATTTTTCTGTAATGGTGGTATGTGTAAATAGGAAAAAGAACTTTAGACGTGAAGACTATTTACTTCTAAGATTATAA
common ontology terms
term enrichment score
TermScore
skeleton0.457143
porites lobata0.387097
porites cylindrica0.387097
coral0.326923
tissue0.296296
mucus0.185185
symphyllia0.173913
ocean0.116838
favites abdita0.095238
physogyra lichtensteini0.095238
pavona varians0.095238
LOWER IN age 8-12 years0.095238
antarctic peninsula0.090909
megaptera novaeangliae0.090909
humpback whale0.090909
antarctica0.083333
state of colorado0.071429
LOWER IN child0.064516
autumn0.062500
oral cavity0.060606
LOWER IN summer0.048780
mouth0.045455
skin0.038462
adult0.010929
united states of america0.007663
homo sapiens0.007143
Fraction of dbbact annotations with this term covered by the query
TermScore
tissue0.500000
porites lobata0.500000
skeleton0.500000
porites cylindrica0.500000
symphyllia0.500000
favites abdita0.500000
physogyra lichtensteini0.500000
pavona varians0.500000
LOWER IN age 8-12 years0.500000
antarctic peninsula0.333333
megaptera novaeangliae0.333333
humpback whale0.333333
coral0.200000
antarctica0.200000
mucus0.142857
state of colorado0.111111
LOWER IN child0.083333
autumn0.076923
oral cavity0.071429
ocean0.062500
LOWER IN summer0.045455
mouth0.040000
skin0.030303
adult0.006098
united states of america0.004132
homo sapiens0.003831
Fraction of annotations for the query sequences containing the term
TermScore
ocean0.894737
coral0.894737
skeleton0.421053
porites lobata0.315789
porites cylindrica0.315789
mucus0.263158
tissue0.210526
symphyllia0.105263
favites abdita0.052632
physogyra lichtensteini0.052632
autumn0.052632
LOWER IN summer0.052632
skin0.052632
antarctica0.052632
antarctic peninsula0.052632
megaptera novaeangliae0.052632
humpback whale0.052632
pavona varians0.052632
adult0.052632
LOWER IN child0.052632
LOWER IN age 8-12 years0.052632
homo sapiens0.052632
united states of america0.052632
oral cavity0.052632
state of colorado0.052632
mouth0.052632
Exp. ID User ID Description Date Region Flag Sequences
418amnondominant ocean, tissue, coral, porites lobata2018-12-02v4No1 / 5
418amnondominant ocean, skeleton, coral, porites lobata2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 6
418amnoncommon ocean, mucus, coral, porites lobata2018-12-02v4No1 / 7
418amnondominant ocean, mucus, coral, porites lobata2018-12-02v4No1 / 8
418amnoncommon ocean, skeleton, coral, porites lobata2018-12-02v4No1 / 8
418amnoncommon ocean, tissue, coral, porites lobata2018-12-02v4No1 / 9
418amnondominant ocean, skeleton, coral, porites cylindrica2018-12-02v4No1 / 11
418amnondominant ocean, mucus, coral, porites cylindrica2018-12-02v4No1 / 12
418amnoncommon ocean, skeleton, coral, symphyllia2018-12-02v4No1 / 13
418amnoncommon ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 14
418amnoncommon ocean, skeleton, coral, favites abdita2018-12-02v4No1 / 18
418amnoncommon ocean, skeleton, coral, physogyra lichtensteini2018-12-02v4No1 / 19
418amnoncommon ocean, skeleton, coral, porites cylindrica2018-12-02v4No1 / 20
418amnoncommon ocean, mucus, coral, porites cylindrica2018-12-02v4No1 / 21
418amnoncommon ocean, mucus, coral, symphyllia2018-12-02v4No1 / 38
275amnonhigher in fall 2010 compared to summer 2013 in whale skin ( high in autumn compared to summer in skin antarctica antarctic peninsula megaptera novaeangliae humpback whale )2018-01-16v4No1 / 42
418amnoncommon ocean, skeleton, coral, pavona varians2018-12-02v4No1 / 42
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133

Problems / suggestions? Please email info AT dbbact DOT org