Search result for sequence:
AATGAACGCTGGCGGCATGCCTAACACATGCAAGTCGAACGAAGGCTTCGGCCTTAGTGGCGCACGGGTGCGTAACGCGTGGGAATCTGCCCTCAGGTTCGGAATAACAGCGAGAAATTGCTGCTAATACCGGATGATATCGCGAGATCA
common ontology terms
term enrichment score
TermScore
canada0.571429
african lion safari0.275862
toronto zoo0.222222
agricultural field0.166667
israel0.158730
captive0.153846
depth 0-10cm0.144578
zoological garden0.142857
neve yaar0.142857
farm0.134351
soil0.111475
irrigated0.111111
food product type0.086957
guizhou province0.086957
kaiyang county0.086957
maize field0.086957
italy0.072727
alfalfa sprouts0.066667
medicago sativa0.066667
pomacea canaliculata0.066667
golden apple snail0.066667
nanheng river0.066667
qingpu district0.066667
cow milk (raw)0.066667
cow milk (fluid)0.066667
milk0.066667
elevation 2000-3000m0.066667
after 6 years0.066667
china0.066586
tap water0.064516
mountain0.064516
skin0.064309
water0.063158
drinking water0.057143
switzerland0.057143
cucumis sativus0.045977
cucumber0.045977
macropus rufus0.045455
red kangaroo0.045455
arctic wolf0.045455
canis lupus arctos0.045455
loam soil0.045455
loam0.045455
tragelaphus oryx0.045455
eland0.045455
clay soil0.045455
sciurus carolinensis0.045455
eastern gray squirrel0.045455
ammotragus lervia0.045455
barbary sheep0.045455
loamy sand soil0.045455
rangifer tarandus0.045455
reindeer0.045455
camelus bactrianus0.045455
bactrian camel0.045455
producer c20.045455
gallbladder0.045455
bile0.045455
producer c10.045455
age 20-30 years0.045455
siliceous parent material0.045455
lowland pasture0.045455
lowland farm0.045455
canton of graubunden0.045455
ph 5.5-60.045455
rhizosphere0.044944
wild horse0.044444
equus asinus africanus0.044444
donkey0.044444
panthera leo0.044444
lion0.044444
cheetah0.044444
pongo abelii0.044444
sumatran orangutan0.044444
giraffe0.044444
dermal layer of tongue0.044444
toronto0.044444
fertilized soil0.044444
sugarcane0.044444
saccharum0.044444
guangzhou city prefecture0.044444
ph 70.044444
unamended soil0.044444
lake0.043956
equus przewalskii0.043478
acinonyx jubatus0.043478
giraffa camelopardalis0.043478
wheat0.043478
bulk soil0.043478
ceratotherium simum0.042553
white rhinoceros0.042553
triticum aestivum0.042553
cat0.041667
tongue0.041667
horse0.040816
kingdom of denmark0.040816
biochar0.040816
equus caballus0.040000
felis catus0.040000
topsoil0.040000
Fraction of dbbact annotations with this term covered by the query
TermScore
canada0.666667
agricultural field0.666667
cucumis sativus0.666667
cucumber0.666667
ixodes fecialis0.500000
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
toronto zoo0.500000
arctic wolf0.500000
canis lupus arctos0.500000
loam soil0.500000
loam0.500000
neve yaar0.500000
tragelaphus oryx0.500000
eland0.500000
clay soil0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
ammotragus lervia0.500000
barbary sheep0.500000
loamy sand soil0.500000
adana province0.500000
turkey0.500000
kombucha0.500000
rangifer tarandus0.500000
reindeer0.500000
camelus bactrianus0.500000
bactrian camel0.500000
food product type0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
producer c20.500000
gallbladder0.500000
bile0.500000
producer c10.500000
vigna radiata0.500000
mung bean sprouts0.500000
fruit0.500000
age 1-18 years0.500000
sri lanka0.500000
age 20-30 years0.500000
pygmy hippopotamus0.500000
hexaprotodon liberiensis0.500000
eidolon helvum0.500000
fruit bat0.500000
LOWER IN treated wastewater0.500000
pteropus giganteus0.500000
indian flying fox0.500000
freshwater lake0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
qingpu district0.500000
buccal mass0.500000
alpine pasture0.500000
alpine0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
cholelithiasis0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
lowland pasture0.500000
lowland farm0.500000
ph 4.5-70.500000
canton of graubunden0.500000
romania0.500000
ursu lake0.500000
hypersaline water0.500000
depth 4-9m0.500000
monimolimnion0.500000
LOWER IN depth 0-3m0.500000
LOWER IN mixolimnion0.500000
treated wastewater0.500000
LOWER IN alpine pasture0.500000
LOWER IN alpine0.500000
LOWER IN ph 6.70.500000
ph 5.5-60.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
calcareous parent material0.500000
straw0.500000
low biochar0.500000
orthic anthrosol0.500000
ph 7.850.500000
guizhou province0.500000
kaiyang county0.500000
maize field0.500000
after 6 years0.500000
ph 7.60.500000
ph 7.90.500000
ph 80.500000
tick0.333333
wild horse0.333333
Fraction of annotations for the query sequences containing the term
TermScore
canada0.500000
skin0.476190
zoological garden0.333333
captive0.333333
soil0.202381
african lion safari0.190476
israel0.178571
toronto zoo0.142857
farm0.130952
china0.130952
depth 0-10cm0.107143
agricultural field0.095238
neve yaar0.083333
irrigated0.071429
water0.071429
homo sapiens0.059524
food product type0.047619
adult0.047619
italy0.047619
guizhou province0.047619
kaiyang county0.047619
maize field0.047619
tap water0.035714
drinking water0.035714
alfalfa sprouts0.035714
medicago sativa0.035714
feces0.035714
pomacea canaliculata0.035714
golden apple snail0.035714
nanheng river0.035714
qingpu district0.035714
cow milk (raw)0.035714
cow milk (fluid)0.035714
milk0.035714
mountain0.035714
switzerland0.035714
elevation 2000-3000m0.035714
rhizosphere0.035714
after 6 years0.035714
equus caballus0.023810
horse0.023810
canis lupus familiaris0.023810
dog0.023810
felis catus0.023810
cat0.023810
macropus rufus0.023810
red kangaroo0.023810
equus przewalskii0.023810
wild horse0.023810
arctic wolf0.023810
canis lupus arctos0.023810
loam soil0.023810
loam0.023810
tragelaphus oryx0.023810
eland0.023810
equus asinus africanus0.023810
donkey0.023810
clay soil0.023810
sciurus carolinensis0.023810
eastern gray squirrel0.023810
ammotragus lervia0.023810
barbary sheep0.023810
panthera leo0.023810
lion0.023810
acinonyx jubatus0.023810
cheetah0.023810
bos taurus0.023810
cow0.023810
loamy sand soil0.023810
rangifer tarandus0.023810
reindeer0.023810
pongo abelii0.023810
sumatran orangutan0.023810
giraffa camelopardalis0.023810
giraffe0.023810
camelus bactrianus0.023810
bactrian camel0.023810
ceratotherium simum0.023810
white rhinoceros0.023810
producer c20.023810
gallbladder0.023810
bile0.023810
kingdom of spain0.023810
producer c10.023810
cucumis sativus0.023810
cucumber0.023810
tongue0.023810
dermal layer of tongue0.023810
toronto0.023810
age 20-30 years0.023810
lake0.023810
siliceous parent material0.023810
lowland pasture0.023810
lowland farm0.023810
canton of graubunden0.023810
ph 5.5-60.023810
fertilized soil0.023810
sugarcane0.023810
saccharum0.023810
topsoil0.023810
Exp. ID User ID Description Date Region Flag Sequences
621amnoncommon ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 5
565amnondominant skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 6
565amnondominant skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 6
565amnondominant skin, canada, felis catus, cat2019-11-21v3No1 / 7
565amnondominant skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 8
565amnondominant skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 8
565amnondominant skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 8
662amnondominant loam soil, loam, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 9
565amnondominant skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 9
565amnondominant skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 9
662amnondominant clay soil, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 10
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 10
565amnondominant skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 10
565amnondominant skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 10
565amnondominant skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 11
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 11
662amnondominant loamy sand soil, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 13
654amnoncommon adana province, turkey, fermented beverage, kombucha2020-09-13v3No1 / 13
565amnondominant skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 13
565amnondominant skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 15
662amnondominant tap water, drinking water, water, israel2020-09-20v3No1 / 16
565amnondominant skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 17
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 19
565amnondominant skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 19
587amnondominant israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 22
565amnoncommon skin, canada, felis catus, cat2019-11-21v3No1 / 25
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 38
587amnoncommon israel, food product type, producer c1, vigna radiata, mung bean sprouts2020-02-10v3No1 / 41
662amnoncommon in cucumber surface (common fruit, israel, neve yaar, cucumis sativus, cucumber, surface)2020-09-22v3No1 / 48
565amnoncommon skin, canada, equus caballus, horse, farm2019-11-21v3No1 / 57
656amnoncommon age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 70
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 71
666amnoncommon pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v3No1 / 76
565amnoncommon skin, canada, canis lupus familiaris, dog2019-11-21v3No1 / 82
565amnoncommon skin, canada, eidolon helvum, fruit bat, zoological garden, toronto zoo, captive2019-11-21v3No1 / 82
662amnon high in drinking water tap water compared to treated wastewater wastewater treatment plant in water israel 2020-09-20v3No1 / 88
662amnoncommon tap water, drinking water, water, israel2020-09-20v3No1 / 88
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 95
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 103
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 105
565amnoncommon skin, canada, pteropus giganteus, indian flying fox, zoological garden, captive, african lion safari2019-11-21v3No1 / 108
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, equus przewalskii, wild horse2019-11-21v3No1 / 111
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, arctic wolf, canis lupus arctos2019-11-21v3No1 / 113
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 121
565amnoncommon skin, canada, zoological garden, captive, african lion safari, ceratotherium simum, white rhinoceros2019-11-21v3No1 / 121
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth 10m2019-09-14v3No1 / 122
565amnoncommon skin, acinonyx jubatus, cheetah, canada, zoological garden, captive, african lion safari2019-11-21v3No1 / 122
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 135
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 136
565amnoncommon skin, canada, zoological garden, captive, african lion safari, elephas maximus, asian elephant2019-11-21v3No1 / 148
565amnoncommon skin, canada, captive, panthera leo, lion, zoological garden, toronto zoo2019-11-21v3No1 / 149
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 154
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 173
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 193
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 204
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 214
583amnoncommon soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 233
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 239
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 256
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 305
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 309
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 317
565amnoncommon skin, canada, equus asinus africanus, donkey, farm2019-11-21v3No1 / 334
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 359
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 367
662amnoncommon clay soil, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 401
577amnon high in hypersaline water high salinity depth 4-9m monimolimnion compared to depth 0-3m mixolimnion low salinity in lake romania ursu lake water lake water 2020-01-09v3No1 / 438
662amnoncommon water, wastewater treatment plant, treated wastewater, israel2020-09-20v3No1 / 472
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 483
662amnoncommon loam soil, loam, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 488
662amnoncommon loamy sand soil, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 608
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in sugarcane saccharum soil topsoil depth 0-20cm china guangzhou city prefecture 2020-04-27v3No1 / 647
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 673
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 680
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 829
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 997
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1008
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1222
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1491
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1636
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1709
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1813
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1871

Problems / suggestions? Please email info AT dbbact DOT org