Search result for sequence:
AGTGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGAGCAAGAGCTGTAGCAATACAGGGTTCTGCTAGTGGCAGACGGGTGAGTAATACATGGGAATCTACCTTGCAGTGCGAAATAACAGTTGGAAGCAATTGCTAATGTCGC
common ontology terms
term enrichment score
TermScore
ixodes fecialis0.500000
australian paralysis tick0.500000
ixodes holocyclus0.500000
tick0.400000
whole body0.250000
body proper0.200000
australia0.100000
Fraction of dbbact annotations with this term covered by the query
TermScore
ixodes fecialis0.500000
australian paralysis tick0.500000
ixodes holocyclus0.500000
tick0.333333
whole body0.142857
body proper0.111111
australia0.052632
Fraction of annotations for the query sequences containing the term
TermScore
body proper1.000000
whole body1.000000
australia1.000000
ixodes fecialis0.500000
tick0.500000
australian paralysis tick0.500000
ixodes holocyclus0.500000

Problems / suggestions? Please email info AT dbbact DOT org