Search result for sequence:
ATTGAACGCTGGCGGCATGCCTTACACATGCAAGTCGAACGGCAGCATGATCTAGCTTGCTAGATTGATGGCGAGTGGCGAACGGGTGAGTAATACATCGGAACGTGCCCTGTAGTGGGGGATAACTAGTCGAAAGATTAGCTAATACCG
common ontology terms
term enrichment score
TermScore
rhizosphere0.187500
united states of america0.170725
water0.164937
whole body0.130081
pacific ocean0.129241
china0.127165
australia0.105263
drinking water0.102009
soil0.099840
sea water0.095238
cat0.091603
tick0.090909
foodon product type0.084706
body proper0.084691
fresh water0.084211
felis catus0.083916
germany0.082397
ocean0.079137
homo sapiens0.073696
river0.072072
state of rhode island0.068627
depth 10 cm0.068627
skin0.067682
breast milk0.062222
coral0.062222
plant0.059406
LOWER IN soil0.058708
brazil0.057732
air0.056604
state of florida0.054545
mucus0.051724
state of california0.051724
koshi river0.050000
minas gerais state0.050000
campos rupestres0.050000
LOWER IN water0.049261
nepal0.048780
depth 0-20cm0.047619
sediment0.043478
greenhouse0.040816
beach0.040404
yellowstone national park0.040404
scomber japonicus0.040404
chub mackerel0.040404
san diego0.040404
adult0.040369
bronchial epithelium0.040000
mountain0.039604
geothermal field0.039604
austria0.039604
nasal cavity0.039344
root0.039024
snow field0.038835
high temperature environment0.038835
bird0.038462
dog0.036364
canis lupus familiaris0.035088
farm0.034985
japan0.034188
poland0.031088
particle bound0.030848
aerosol0.030612
tributary0.030612
gill0.030612
centrocercus urophasianus0.030612
greater sage-grouse0.030612
state of wyoming0.030612
south florida0.030612
shark0.030612
philippine sea0.030612
cultivated environment0.030303
LOWER IN sea water0.030303
beetle0.030151
depth 1-2m0.030151
filtered 0.2um0.030151
biofilm0.030151
soybean0.030151
surface water0.030000
LOWER IN saliva0.029851
glycine max0.029703
lung0.029484
free floating0.029268
usa0.029268
atlantic ocean0.028037
digestive system0.027523
infant0.027273
leaf0.027273
mouth0.026906
fish0.025862
feces0.024671
control0.023881
research facility0.023392
mouse0.022388
mus musculus0.021544
canada0.020725
citrus0.020725
wombat tick0.020619
bothriocroton auruginans0.020619
ixodes australiensis0.020619
santa cruz province0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
poland1.000000
greenhouse0.666667
particle bound0.666667
canada0.666667
citrus0.666667
haemaphysalis0.500000
haemaphysalis bancrofti0.500000
LOWER IN allergy0.500000
LOWER IN atopic dermatitis0.500000
bothriocroton concolor0.500000
wombat tick0.500000
bothriocroton auruginans0.500000
ixodes australiensis0.500000
turbinaria reniformis0.500000
australian paralysis tick0.500000
ixodes holocyclus0.500000
haemaphysalis humerosa0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
ixodes ornithorhynchi0.500000
state of rhode island0.500000
fish sauce0.500000
galaxea astreata0.500000
plant0.500000
nida basin0.500000
herbivorous beetle0.500000
centricnemus leucogrammus0.500000
LOWER IN depth 6-7m0.500000
lower back0.500000
yellowstone national park0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
fungus growing ant0.500000
mycocepurus smithii0.500000
seriatopora caliendrum0.500000
pavona varians0.500000
groin0.500000
nasal cavity mucosa0.500000
ixodes antechini0.500000
cinara0.500000
acropora hyacinthus0.500000
tissue0.500000
LOWER IN oropharynx0.500000
LOWER IN oropharyngeal swab0.500000
endotracheal aspirate0.500000
trachea0.500000
respiratory failure0.500000
acute respiratory failure0.500000
arawacus togarna0.500000
thermophilic sediment0.500000
kangaroo tick0.500000
amblyomma triguttatum0.500000
onion0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
radish0.500000
gill0.500000
scomber japonicus0.500000
chub mackerel0.500000
san diego0.500000
interdigital region0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
depth 6-7m0.500000
pikas0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
bermuda0.500000
porites astreoides0.500000
agave0.500000
guanajuato0.500000
agave tequiliana0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
LOWER IN caecum0.500000
beginning0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
turtle farm0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
cabbage0.500000
LOWER IN oral wash0.500000
colon0.500000
epidermis0.500000
malvaviscus penduliflorus0.500000
south florida0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.342105
water0.136842
rhizosphere0.126316
china0.121053
homo sapiens0.110526
whole body0.084211
pacific ocean0.084211
australia0.078947
body proper0.068421
soil0.068421
cat0.063158
felis catus0.063158
sea water0.063158
ocean0.057895
drinking water0.057895
germany0.057895
tick0.052632
fresh water0.052632
foodon product type0.047368
skin0.042105
river0.042105
breast milk0.036842
coral0.036842
state of rhode island0.036842
depth 10 cm0.036842
adult0.036842
brazil0.036842
mucus0.031579
state of california0.031579
air0.031579
plant0.031579
state of florida0.031579
LOWER IN soil0.031579
feces0.031579
sediment0.026316
LOWER IN water0.026316
koshi river0.026316
nepal0.026316
depth 0-20cm0.026316
minas gerais state0.026316
campos rupestres0.026316
control0.021053
research facility0.021053
beach0.021053
snow field0.021053
mountain0.021053
japan0.021053
yellowstone national park0.021053
geothermal field0.021053
high temperature environment0.021053
nasal cavity0.021053
austria0.021053
bronchial epithelium0.021053
dog0.021053
canis lupus familiaris0.021053
scomber japonicus0.021053
chub mackerel0.021053
san diego0.021053
root0.021053
bird0.021053
farm0.021053
greenhouse0.021053
mus musculus0.015789
mouse0.015789
mouth0.015789
aerosol0.015789
poland0.015789
beetle0.015789
depth 1-2m0.015789
tributary0.015789
free floating0.015789
filtered 0.2um0.015789
digestive system0.015789
lung0.015789
LOWER IN saliva0.015789
gill0.015789
fish0.015789
usa0.015789
cultivated environment0.015789
centrocercus urophasianus0.015789
greater sage-grouse0.015789
state of wyoming0.015789
LOWER IN sea water0.015789
infant0.015789
biofilm0.015789
leaf0.015789
atlantic ocean0.015789
south florida0.015789
shark0.015789
glycine max0.015789
soybean0.015789
particle bound0.015789
philippine sea0.015789
surface water0.015789
finland0.010526
wombat tick0.010526
bothriocroton auruginans0.010526
ixodes australiensis0.010526
oral cavity0.010526
balb/c0.010526
Exp. ID User ID Description Date Region Flag Sequences
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 3
621amnoncommon tick, haemaphysalis, haemaphysalis bancrofti, body proper, whole body, australia2020-05-07v1No1 / 3
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to allergy atopic dermatitis in cat felis catus skin united states of america )2017-07-05v4No1 / 4
621amnoncommon tick, bothriocroton concolor, body proper, whole body, australia2020-05-07v1No1 / 5
621amnoncommon wombat tick, bothriocroton auruginans, body proper, whole body, australia2020-05-07v1No1 / 5
621amnoncommon tick, ixodes australiensis, body proper, whole body, australia2020-05-07v1No1 / 5
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 6
418amnondominant coral, ocean, turbinaria reniformis, mucus2018-12-02v4No1 / 6
621amnoncommon body proper, whole body, australian paralysis tick, ixodes holocyclus, australia2020-05-07v1No1 / 6
621amnoncommon haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 7
621amnondominant wombat tick, bothriocroton auruginans, body proper, whole body, australia2020-05-07v1No1 / 7
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 8
621amnondominant tick, ixodes australiensis, body proper, whole body, australia2020-05-07v1No1 / 8
304amnondominant united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 9
621amnondominant ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 9
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 10
418amnondominant coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 10
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 10
287amnon high in depth 1-2m compared to depth 6-7m in snow field mountain japan 2018-01-29v4No1 / 11
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 12
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 12
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 12
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 12
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 13
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 13
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 13
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 14
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 14
418amnondominant coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 14
418amnondominant coral, ocean, pavona varians, mucus2018-12-02v4No1 / 14
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 15
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 15
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 15
621amnoncommon ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 15
68amnonfound in some aphid samples (prevalence <=0.1) (other cinara)2017-02-20v4No1 / 16
158amnondominant cat, felis catus, united states of america, axilla2017-07-06v4No1 / 16
287amnondominant snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 16
418amnondominant coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 16
158amnondominant cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 17
636amnon high in tracheal aspirate endotracheal aspirate trachea compared to oropharynx oropharyngeal swab in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 17
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 18
621amnoncommon tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 18
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 20
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 20
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 21
198amnondominant sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 22
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 23
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 24
621amnoncommon kangaroo tick, amblyomma triguttatum, tick, body proper, whole body, australia2020-05-07v1No1 / 24
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 25
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 25
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 26
109amnoncommon water, drinking water, united states of america, site b2017-04-08v4No1 / 30
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 33
287amnoncommon snow field, mountain, depth 1-2m, japan2018-01-29v4No1 / 34
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 35
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 35
158amnoncommon cat, felis catus, united states of america, axilla2017-07-06v4No1 / 36
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 36
642amnon high in winter compared to summer in gill fish scomber japonicus chub mackerel san diego pacific ocean 2020-08-28v4No1 / 36
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 39
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 41
275amnonhigher in fall 2010 compared to summer 2013 in whale skin ( high in autumn compared to summer in megaptera novaeangliae humpback whale antarctica antarctic peninsula skin )2018-01-16v4No1 / 41
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 42
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 42
287amnoncommon snow field, mountain, depth 6-7m, japan2018-01-29v4No1 / 46
279amnon high in mouth compared to small intestine stomach in ochotonidae pikas china 2018-01-24v4No1 / 52
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 53
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 54
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 60
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 61
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 63
109amnoncommon water, drinking water, united states of america, site d2017-04-08v4No1 / 66
642amnon high in chub mackerel scomber japonicus skin compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 66
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 67
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 68
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 70
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 79
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 79
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 82
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 82
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 83
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 83
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 84
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 84
109amnoncommon usa, water, drinking water, site c2017-04-08v4No1 / 85
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 93
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 96
196amnonlower in water compared to biofilm ( high in biofilm compared to water in drinking water united states of america )2017-09-12v4No1 / 99
642amnon high in skin epidermis compared to gill in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 99
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 101
198amnoncommon yellowstone national park, united states of america, geothermal field, water, hot spring, high temperature environment2017-09-13v4No1 / 102
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water depth 0m sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 106
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 109
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 112
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 112
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 117
196amnoncommon in biofilm in tap water (common water, drinking water, united states of america, biofilm)2017-09-12v4No1 / 120
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 120
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 120
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 126
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 142
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 143
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 145
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 146
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 148
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 152
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 153
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 160
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 161
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 167
323amnoncommon in shark gills (common atlantic ocean, south florida, state of florida, united states of america, shark, gill)2018-04-24v4No1 / 169
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 171
196amnoncommon water, drinking water, united states of america2017-09-12v4No1 / 177
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 179
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 182
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 192
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 192
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 193
323amnoncommon in shark skin (common atlantic ocean, south florida, state of florida, united states of america, shark, skin)2018-04-24v4No1 / 212
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth 5m, sea water)2017-04-18v4No1 / 213
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 231
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 235
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 235
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 262
635amnoncommon hervey bay, surface water, sea water, australia2020-08-03v1No1 / 264
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 266
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 274
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 297
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 305
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 314
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 315
342amnoncommon water, pacific ocean, philippine sea, depth 300m, sea water2018-05-28v4No1 / 322
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 364
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 382
170amnonhigher in low turbidity river water ( high in low turbidity turbidity compared to high turbidity in river water fresh water depth 10 cm united states of america stream )2017-07-24v4No1 / 394
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 396
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 407
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 419
642amnon high in gill compared to alimentary part of gastrointestinal system gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 433
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 500
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 517
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 543
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth 1000m)2017-04-18v4No1 / 565
138amnoncommon in ocean water depth 150-500m (common sea water, ocean, pacific ocean, depth 150-500m)2017-04-18v4No1 / 581
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 589
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 589
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 650
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth 2000-4000m)2017-04-18v4No1 / 673
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 749
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 799
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 799
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 823
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 829
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 893
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 923
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 945
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1022
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1039
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1080
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1150
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1174
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1180
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1193
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1216
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1217
309amnoncommon rhizosphere, germany, latyrus pratensis, meadow pea-vine2018-04-05v4No1 / 1295
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1322
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1333
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1385
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1419
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1433
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1438
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1458
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1482
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1509
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1598
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1598
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1658
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1662
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1787
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1884
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2855
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3276
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3507
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4261

Problems / suggestions? Please email info AT dbbact DOT org