Search result for sequence:
ATTGAACGCTGGCGGCATGCCTTACACATGCAAGTCGAACGGTAACAGGTCTTCGGACGCTGACGAGTGGCGAACGGGTGAGTAATACATCGGAACGTGCCCAGTCGTGGGGGATAACTACTCGAAAGAGTAGCTAATACCGCATACGAT
common ontology terms
term enrichment score
TermScore
skin0.221607
united states of america0.182241
costa rica0.127413
digestive system0.118289
homo sapiens0.110550
southern united states0.109091
research facility0.104510
snake0.103448
canis lupus familiaris0.102828
germany0.091429
intestine0.084656
soil0.083383
butterfly0.083333
canada0.078431
tick0.076923
newt0.076923
adult0.075472
australia0.073171
pair of nares0.072727
farm0.071322
china0.070796
body proper0.068966
nasopharynx0.067797
cambridgeshire0.063694
mucus0.063025
LOWER IN saliva0.060484
depth 0-20cm0.059880
air0.057307
whole body0.054945
dog0.054201
water0.052980
city0.052083
united kingdom0.052083
hong kong0.051613
cow milk (raw)0.051613
cow milk (fluid)0.051613
milk0.051613
beagle dog0.051613
nasal wash0.051613
state of rhode island0.051613
urocyon littoralis catalinae0.051613
santa catalina island fox0.051613
santa catalina island0.051613
urocyon littoralis0.051613
nasal cavity0.050955
frog0.050740
sinusoidal space0.050314
paranasal sinus0.050314
rhizosphere0.049505
mucosa0.049080
food (fermented)0.049080
fish0.048290
leaf0.047904
brazil0.045198
italy0.040201
lowland pasture0.039216
lowland farm0.039216
lissotriton vulgaris0.039216
cannabis sativa0.039216
fossorial snake0.039216
austria0.039216
ensete ventricosum0.039216
ethiopian banana0.039216
days 30-600.039216
anaerobic fermentation0.039216
amphibia0.039216
pomacea canaliculata0.039216
golden apple snail0.039216
nanheng river0.039216
qingpu district0.039216
pond0.039216
urine0.038835
bronchial epithelium0.038835
bronchoalveolar lavage0.038462
soybean0.038462
sea water0.038278
french republic0.038095
sinusitis0.037736
root endosphere0.037736
ethiopia0.037736
late timepoint0.037736
glycine max0.037736
control0.037383
LOWER IN wild0.037037
LOWER IN feces0.036364
wild0.035874
israel0.035714
root0.031250
LOWER IN control0.027491
graz city district0.026667
salamander0.026667
whole plant0.026667
toad0.026667
subway0.026490
yellowstone national park0.026490
ixodes antechini0.026490
propagation stage0.026490
hydrothermal vent0.026490
greece0.026490
marine hydrothermal vent0.026490
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
tick0.666667
newt0.666667
graz city district0.666667
salamander0.666667
whole plant0.666667
toad0.666667
pyrisitia nise0.500000
mimosa yellow butterfly0.500000
eurema albula0.500000
ghost yellow butterfly0.500000
ixodes fecialis0.500000
aphrissa boisduvalii0.500000
haemaphysalis humerosa0.500000
ant0.500000
pseudomyrmex cubaensis0.500000
hong kong0.500000
subway0.500000
lowland pasture0.500000
lowland farm0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
yellowstone national park0.500000
chlosyne gaudialis0.500000
beagle dog0.500000
ixodes ornithorhynchi0.500000
ixodes antechini0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
nasal wash0.500000
parkinson's disease0.500000
reagent0.500000
LOWER IN days 0-30.500000
days 57-600.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
ixodes scapularis0.500000
LOWER IN pixr immunized0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
propagation stage0.500000
cannabis sativa0.500000
arawacus togarna0.500000
contact lens0.500000
rem sleep behavior disorder0.500000
nasal brush0.500000
southern united states0.500000
diadophis punctatus0.500000
ringneck snake0.500000
fossorial snake0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
east antarctica0.500000
nunatak0.500000
depth 2cm0.500000
mimelia0.500000
carphophis amoenus0.500000
worm snake0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
nasal cavity mucosa0.500000
austria0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
LOWER IN inactive vent0.500000
anoplophora glabripennis0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
temp 20c0.500000
LOWER IN temp 10c0.500000
cadmium0.500000
reproductive system0.500000
reproductive organ0.500000
genitalia0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
bronchial brush0.500000
LOWER IN sputum0.500000
LOWER IN induced sputum0.500000
coarse-loamy soil0.500000
day 120.500000
LOWER IN day 10.500000
bermuda0.500000
porites astreoides0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.394558
homo sapiens0.176871
skin0.163265
research facility0.129252
adult0.095238
digestive system0.088435
china0.081633
costa rica0.074830
canis lupus familiaris0.068027
soil0.068027
snake0.061224
southern united states0.061224
germany0.054422
farm0.054422
intestine0.054422
butterfly0.047619
australia0.047619
tick0.040816
body proper0.040816
nasopharynx0.040816
control0.040816
water0.040816
newt0.040816
canada0.040816
pair of nares0.040816
whole body0.034014
air0.034014
city0.034014
cambridgeshire0.034014
united kingdom0.034014
dog0.034014
mucus0.034014
LOWER IN saliva0.034014
depth 0-20cm0.034014
rhizosphere0.034014
mucosa0.027211
sinusoidal space0.027211
paranasal sinus0.027211
LOWER IN control0.027211
hong kong0.027211
italy0.027211
cow milk (raw)0.027211
cow milk (fluid)0.027211
milk0.027211
beagle dog0.027211
nasal wash0.027211
nasal cavity0.027211
sea water0.027211
fish0.027211
state of rhode island0.027211
food (fermented)0.027211
leaf0.027211
urocyon littoralis catalinae0.027211
santa catalina island fox0.027211
santa catalina island0.027211
wild0.027211
urocyon littoralis0.027211
frog0.027211
brazil0.027211
sinusitis0.020408
lowland pasture0.020408
lowland farm0.020408
bronchoalveolar lavage0.020408
LOWER IN wild0.020408
lissotriton vulgaris0.020408
root0.020408
root endosphere0.020408
cannabis sativa0.020408
fossorial snake0.020408
urine0.020408
austria0.020408
feces0.020408
bronchial epithelium0.020408
ethiopia0.020408
ensete ventricosum0.020408
ethiopian banana0.020408
late timepoint0.020408
days 30-600.020408
anaerobic fermentation0.020408
israel0.020408
amphibia0.020408
pomacea canaliculata0.020408
golden apple snail0.020408
nanheng river0.020408
qingpu district0.020408
french republic0.020408
pond0.020408
LOWER IN feces0.020408
glycine max0.020408
soybean0.020408
contamination0.013605
stomach0.013605
subway0.013605
yellowstone national park0.013605
geothermal field0.013605
sediment0.013605
LOWER IN water0.013605
high temperature environment0.013605
ixodes antechini0.013605
larval stage0.013605
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon costa rica, butterfly, digestive system, pyrisitia nise, mimosa yellow butterfly2019-03-08v4No1 / 5
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 5
621amnoncommon ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 5
501amnoncommon costa rica, butterfly, digestive system, aphrissa boisduvalii2019-03-08v4No1 / 6
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 7
621amnoncommon haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 7
607amnonhigher in blanks compared to nasopharyngeal samples (contamination)2020-04-19v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 9
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 10
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v4No1 / 10
617amnondominant lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 10
198amnon high in sediment compared to water in yellowstone national park united states of america geothermal field high temperature environment 2017-09-14v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 12
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v4No1 / 13
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 14
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 14
621amnoncommon ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 15
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 15
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 16
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 16
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 16
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 18
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 18
621amnoncommon tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 18
614amnonincreases in picher plant fluid grown in lab ( high in research facility days 57-60 late time points compared to wild days 0-3 early time points in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 19
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 19
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 19
618amnondominant canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 20
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 20
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 22
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 24
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 25
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 25
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 26
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 30
527amnoncommon soil, antarctica, east antarctica, nunatak, depth 2cm, mimelia2019-07-14v4No1 / 32
536amnoncommon snake, skin, united states of america, southern united states, carphophis amoenus, worm snake, fossorial snake2019-07-28v4No1 / 34
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 35
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 36
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 36
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 37
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 38
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 39
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 42
618amnoncommon canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 44
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 46
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 54
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 56
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 )2020-03-27v4No1 / 59
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 60
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 61
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 63
536amnoncommon snake, skin, united states of america, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 63
341amnoncommon water, drinking water, united states of america, tap water, state of illinois, fresh water2018-05-28v4No1 / 65
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 67
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 68
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 71
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 73
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 76
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 79
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 79
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 80
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 83
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 83
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 84
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 85
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 85
9amnoncommon bermuda, sea water2016-10-27v4No1 / 90
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, external naris, pair of nares2020-01-22v4No1 / 91
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 93
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 95
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 100
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 100
377amnoncommon salamandra salamandra, salamander, skin, germany2018-09-12v4No1 / 105
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 105
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 110
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature environment2017-09-13v4No1 / 112
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 114
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 117
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 120
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 122
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 123
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 126
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 128
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 132
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 134
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 135
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 135
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 136
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, axilla2020-01-22v4No1 / 139
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 143
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 145
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 146
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 149
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 150
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 156
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 156
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 157
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 160
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 170
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 175
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 183
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 193
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 194
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 195
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 199
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 200
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 214
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 235
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 239
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 240
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 256
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 266
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 272
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 297
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 307
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 323
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 327
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 364
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 373
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 378
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 470
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 483
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 489
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 509
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 509
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 621
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 749
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 889
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 965
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1174
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1228
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1276
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1419
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1458
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1709
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7953

Problems / suggestions? Please email info AT dbbact DOT org