Search result for sequence:
ATTGAACGCTGGCGGTATGCCTAACACATGCAAGTCGAACGGCAGCACGTTAAAGATTTCGGTCTTTATGGGTGGCAAGTGGCGGACGGGTGAGTAATAGGTAGGAATCTATCCTGGAGATAAGGATAACTTGCGGAAACGCGAGCTAAT
common ontology terms
term enrichment score
TermScore
tick0.500000
ixodes australiensis0.444444
haemaphysalis humerosa0.285714
ixodes tasmani0.285714
ixodes antechini0.285714
whole body0.250000
body proper0.200000
australia0.100000
Fraction of dbbact annotations with this term covered by the query
TermScore
ixodes australiensis0.500000
haemaphysalis humerosa0.500000
ixodes tasmani0.500000
ixodes antechini0.500000
tick0.333333
whole body0.142857
body proper0.111111
australia0.052632
Fraction of annotations for the query sequences containing the term
TermScore
tick1.000000
body proper1.000000
whole body1.000000
australia1.000000
ixodes australiensis0.400000
haemaphysalis humerosa0.200000
ixodes tasmani0.200000
ixodes antechini0.200000

Problems / suggestions? Please email info AT dbbact DOT org