Search result for sequence:
CACCGGCAGCTCTAGTGGTAGCAGTTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGCAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGATCGGGAGAGGTTAGAGGTACTCCCA
common ontology terms
term enrichment score
TermScore
zoological garden0.329177
homo sapiens0.291998
feces0.269533
adult0.219250
pig0.153518
sus scrofa0.153518
gorilla gorilla0.149533
united states of america0.129293
rural community0.127737
canada0.118644
como zoo0.110092
farm0.102790
skin0.101124
city0.096774
child0.092920
colombia0.091324
state of minnesota0.090226
captive0.086331
obsolete_juvenile stage0.081967
hunter gatherer0.078176
african lion safari0.076190
nouabale-ndoki national park0.076190
republic of congo0.076190
LOWER IN crohn's disease0.075472
egypt0.074766
monkey0.070796
pregnancy0.062016
wild0.061069
united kingdom0.060150
venezuela0.059113
amerindian0.059113
tonsil0.059113
papio anubis0.059113
caecum0.059113
glasgow0.058252
left colon0.058252
pan troglodytes0.058252
chimpanzee0.058252
chuquisaca department0.058252
right colon0.057416
biopsy0.056604
age 5-13 years0.056604
french republic0.055814
state of michigan0.055814
bolivia0.055046
control0.054019
israel0.053691
female0.052770
metabolic syndrome0.040000
LOWER IN obsolete_juvenile stage0.040000
olive baboon0.040000
gorilla0.039604
black-handed spider monkey0.039604
ateles geoffroyi0.039604
third trimester0.039604
age 12-19 weeks0.039604
gay0.039604
LOWER IN heterosexual0.039604
LOWER IN msw0.039604
myanmar0.039604
karen0.039604
age 130.039604
camel0.039604
camelus dromedarius0.039604
LOWER IN pan troglodytes troglodytes0.039604
lincoln park zoo0.039604
toronto zoo0.039604
LOWER IN infant0.039216
homosexual0.039216
msm0.039216
pongo abelii0.038835
sumatran orangutan0.038835
first trimester0.038835
thailand0.038835
jiangxi province0.038835
chicago0.038835
LOWER IN mouth mucosa0.038835
india0.038462
state of colorado0.038462
LOWER IN child0.038462
biopsy site0.038095
juvenile organism0.038095
LOWER IN united states of america0.037736
LOWER IN ileum0.037736
LOWER IN wild0.037383
state of tennessee0.037383
rectum0.037383
biofilm0.036697
finland0.036036
LOWER IN mouth0.036036
rumen0.033058
kingdom of spain0.033058
river0.033058
metabolic syndrome x0.020202
rangifer tarandus0.020202
reindeer0.020202
LOWER IN gangcha region0.020202
gannan tibetan autonomous prefecture0.020202
denver0.020202
fresh clover diet0.020202
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.800000
hunter gatherer0.750000
metabolic syndrome0.666667
venezuela0.666667
amerindian0.666667
LOWER IN obsolete_juvenile stage0.666667
tonsil0.666667
papio anubis0.666667
olive baboon0.666667
caecum0.666667
zoological garden0.600000
rural community0.555556
gorilla0.500000
como zoo0.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
glasgow0.500000
metabolic syndrome x0.500000
third trimester0.500000
rangifer tarandus0.500000
reindeer0.500000
african lion safari0.500000
age 12-19 weeks0.500000
left colon0.500000
gay0.500000
LOWER IN heterosexual0.500000
LOWER IN msw0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
denver0.500000
myanmar0.500000
karen0.500000
age 130.500000
camel0.500000
camelus dromedarius0.500000
fresh clover diet0.500000
LOWER IN clover hay diet0.500000
LOWER IN india0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
cameroon0.500000
yaounde0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
white-faced saki0.500000
pithecia pithecia0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
village0.500000
spondyloarthritis0.500000
spondylitis0.500000
ammotragus lervia0.500000
barbary sheep0.500000
sucram0.500000
LOWER IN standard feed0.500000
toronto0.500000
LOWER IN age 6-10 weeks0.500000
bangladesh0.500000
tunapuco0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN hmong0.500000
LOWER IN pan troglodytes troglodytes0.500000
LOWER IN chimpanzee0.500000
lincoln park zoo0.500000
pan troglodytes0.500000
chimpanzee0.500000
macropus rufus0.500000
red kangaroo0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
gorilla gorilla gorilla0.500000
toronto zoo0.500000
santa catalina island0.500000
urocyon littoralis0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
perianal skin0.500000
LOWER IN ear canal0.500000
LOWER IN external acoustic meatus0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
LOWER IN alpine pasture0.500000
LOWER IN alpine0.500000
lowland farm0.500000
lowland pasture0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.731959
homo sapiens0.567010
united states of america0.329897
adult0.278351
zoological garden0.226804
skin0.092784
pig0.092784
sus scrofa0.092784
gorilla gorilla0.082474
canada0.072165
farm0.072165
control0.072165
child0.072165
rural community0.072165
state of minnesota0.061856
como zoo0.061856
city0.061856
captive0.061856
colombia0.051546
female0.051546
obsolete_juvenile stage0.051546
monkey0.041237
israel0.041237
pregnancy0.041237
hunter gatherer0.041237
african lion safari0.041237
LOWER IN crohn's disease0.041237
egypt0.041237
wild0.041237
nouabale-ndoki national park0.041237
republic of congo0.041237
united kingdom0.041237
french republic0.030928
glasgow0.030928
venezuela0.030928
amerindian0.030928
biopsy0.030928
right colon0.030928
tonsil0.030928
state of michigan0.030928
left colon0.030928
papio anubis0.030928
pan troglodytes0.030928
chimpanzee0.030928
caecum0.030928
age 5-13 years0.030928
bolivia0.030928
chuquisaca department0.030928
gorilla0.020619
pongo abelii0.020619
sumatran orangutan0.020619
black-handed spider monkey0.020619
ateles geoffroyi0.020619
metabolic syndrome0.020619
first trimester0.020619
third trimester0.020619
LOWER IN infant0.020619
LOWER IN obsolete_juvenile stage0.020619
india0.020619
biopsy site0.020619
age 12-19 weeks0.020619
state of colorado0.020619
gay0.020619
homosexual0.020619
msm0.020619
LOWER IN heterosexual0.020619
LOWER IN msw0.020619
LOWER IN child0.020619
myanmar0.020619
thailand0.020619
karen0.020619
age 130.020619
juvenile organism0.020619
finland0.020619
camel0.020619
camelus dromedarius0.020619
rumen0.020619
LOWER IN united states of america0.020619
LOWER IN ileum0.020619
jiangxi province0.020619
china0.020619
olive baboon0.020619
LOWER IN pan troglodytes troglodytes0.020619
lincoln park zoo0.020619
chicago0.020619
LOWER IN wild0.020619
toronto zoo0.020619
state of tennessee0.020619
rectum0.020619
LOWER IN mouth mucosa0.020619
LOWER IN mouth0.020619
kingdom of spain0.020619
biofilm0.020619
river0.020619
metabolic syndrome x0.010309
infant0.010309
lean body mass0.010309
low bmi0.010309
LOWER IN high bmi0.010309
rangifer tarandus0.010309
Exp. ID User ID Description Date Region Flag Sequences
406amnondominant feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 15
625amnondominant pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 16
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
625amnondominant black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 22
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnondominant homo sapiens, feces, united states of america2017-04-16v4No1 / 23
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 196
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
620amnon high in gorilla gorilla compared to pan troglodytes troglodytes chimpanzee in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 351
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 414
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org