Search result for sequence:
CACCGGCAGCTCTAGTGGTAGCAGTTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGCAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGATCGGGAGAGGTTAGAGGTACTCCCA
common ontology terms
term enrichment score
TermScore
homo sapiens0.319902
feces0.274100
adult0.241847
pig0.201681
sus scrofa0.201681
zoological garden0.151899
rural community0.150943
child0.126126
colombia0.122699
united states of america0.115190
hunter gatherer0.107623
obsolete_juvenile stage0.106383
city0.102740
LOWER IN crohn's disease0.102564
egypt0.101266
farm0.094637
monkey0.094118
gorilla gorilla0.081633
venezuela0.081633
amerindian0.081633
tonsil0.081633
glasgow0.080000
left colon0.080000
age 5-13 years0.080000
chuquisaca department0.080000
biopsy0.078431
right colon0.078431
united kingdom0.076190
french republic0.075472
state of michigan0.075472
bolivia0.074074
control0.066986
caecum0.058824
metabolic syndrome0.055556
LOWER IN obsolete_juvenile stage0.055556
gay0.055556
homosexual0.055556
msm0.055556
LOWER IN heterosexual0.055556
LOWER IN msw0.055556
gorilla0.054795
age 12-19 weeks0.054795
myanmar0.054795
thailand0.054795
karen0.054795
age 130.054795
camel0.054795
camelus dromedarius0.054795
papio anubis0.054795
LOWER IN mouth mucosa0.054795
LOWER IN infant0.054054
india0.053333
LOWER IN child0.053333
jiangxi province0.053333
state of colorado0.052632
biopsy site0.051948
juvenile organism0.051948
LOWER IN ileum0.051948
state of tennessee0.050633
biofilm0.049383
finland0.048193
LOWER IN mouth0.048193
kingdom of spain0.044944
rumen0.043956
skin0.043011
river0.043011
metabolic syndrome x0.028169
LOWER IN gangcha region0.028169
gannan tibetan autonomous prefecture0.028169
denver0.028169
fresh clover diet0.028169
LOWER IN clover hay diet0.028169
LOWER IN india0.028169
kebbi state0.028169
age 10-15 years0.028169
urinary schistosomiasis0.028169
schistosomiasis0.028169
LOWER IN age 1-3 weeks0.028169
hadza0.028169
preweaned0.028169
age 2-4 weeks0.028169
suckling0.028169
spondyloarthritis0.028169
spondylitis0.028169
sucram0.028169
LOWER IN standard feed0.028169
toronto0.028169
LOWER IN age 6-10 weeks0.028169
bangladesh0.028169
tunapuco0.028169
weaned0.028169
age 4-7 weeks0.028169
corn and soybean diet0.028169
olive baboon0.028169
LOWER IN nepal0.028169
LOWER IN himalayas0.028169
LOWER IN hmong0.028169
zambia0.028169
baboon0.028169
papio0.028169
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
gorilla gorilla0.666667
metabolic syndrome0.666667
venezuela0.666667
amerindian0.666667
LOWER IN obsolete_juvenile stage0.666667
tonsil0.666667
gay0.666667
homosexual0.666667
msm0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
zoological garden0.600000
rural community0.571429
gorilla0.500000
glasgow0.500000
metabolic syndrome x0.500000
age 12-19 weeks0.500000
left colon0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
denver0.500000
myanmar0.500000
thailand0.500000
karen0.500000
age 130.500000
camel0.500000
camelus dromedarius0.500000
fresh clover diet0.500000
LOWER IN clover hay diet0.500000
LOWER IN india0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
LOWER IN age 1-3 weeks0.500000
hadza0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
spondyloarthritis0.500000
spondylitis0.500000
sucram0.500000
LOWER IN standard feed0.500000
toronto0.500000
LOWER IN age 6-10 weeks0.500000
bangladesh0.500000
tunapuco0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
papio anubis0.500000
olive baboon0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN hmong0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
pan troglodytes0.500000
chimpanzee0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
sigmoid colon0.500000
children0.500000
age 5-13 years0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN mouth mucosa0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
forearm0.500000
epilithic0.500000
pig0.444444
sus scrofa0.444444
LOWER IN crohn's disease0.444444
colombia0.400000
LOWER IN infant0.400000
biopsy0.400000
right colon0.400000
egypt0.400000
india0.333333
lean body mass0.333333
tibet autonomous region0.333333
LOWER IN child0.333333
nigeria0.333333
tanzania0.333333
jiangxi province0.333333
peru0.333333
jejunum0.333333
south america0.333333
terminal ileum0.333333
LOWER IN jejunum0.333333
foot0.333333
diabetes mellitus0.333333
arm0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.753623
homo sapiens0.710145
adult0.318841
united states of america0.304348
pig0.130435
sus scrofa0.130435
control0.101449
child0.101449
zoological garden0.086957
rural community0.086957
colombia0.072464
city0.072464
farm0.072464
obsolete_juvenile stage0.072464
monkey0.057971
hunter gatherer0.057971
LOWER IN crohn's disease0.057971
egypt0.057971
united kingdom0.057971
french republic0.043478
gorilla gorilla0.043478
glasgow0.043478
venezuela0.043478
amerindian0.043478
biopsy0.043478
right colon0.043478
tonsil0.043478
state of michigan0.043478
left colon0.043478
caecum0.043478
age 5-13 years0.043478
bolivia0.043478
chuquisaca department0.043478
gorilla0.028986
metabolic syndrome0.028986
LOWER IN infant0.028986
LOWER IN obsolete_juvenile stage0.028986
india0.028986
biopsy site0.028986
age 12-19 weeks0.028986
state of colorado0.028986
gay0.028986
homosexual0.028986
msm0.028986
LOWER IN heterosexual0.028986
LOWER IN msw0.028986
LOWER IN child0.028986
myanmar0.028986
thailand0.028986
karen0.028986
age 130.028986
juvenile organism0.028986
finland0.028986
camel0.028986
camelus dromedarius0.028986
rumen0.028986
LOWER IN ileum0.028986
jiangxi province0.028986
china0.028986
papio anubis0.028986
state of tennessee0.028986
LOWER IN mouth mucosa0.028986
LOWER IN mouth0.028986
skin0.028986
kingdom of spain0.028986
biofilm0.028986
river0.028986
metabolic syndrome x0.014493
infant0.014493
lean body mass0.014493
low bmi0.014493
LOWER IN high bmi0.014493
tibet autonomous region0.014493
tibetan plateau0.014493
LOWER IN gangcha region0.014493
gannan tibetan autonomous prefecture0.014493
denver0.014493
female0.014493
fresh clover diet0.014493
LOWER IN clover hay diet0.014493
LOWER IN india0.014493
LOWER IN united states of america0.014493
nigeria0.014493
kebbi state0.014493
age 10-15 years0.014493
urinary schistosomiasis0.014493
schistosomiasis0.014493
age 4 weeks0.014493
LOWER IN age 1-3 weeks0.014493
tanzania0.014493
hadza0.014493
kingdom of norway0.014493
LOWER IN colon0.014493
preweaned0.014493
age 2-4 weeks0.014493
suckling0.014493
LOWER IN ulcerative colitis0.014493
spondyloarthritis0.014493
spondylitis0.014493
brazil0.014493
Exp. ID User ID Description Date Region Flag Sequences
406amnonhighfreq feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 15
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
73amnonhighfreq homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org