Search result for sequence:
CACGAACCGGACAAACGTTATTCGGAATTATTGGGCTTAAAGGGTGTGTAGGCGGTCATGTAGGTGGGGTGTGAAATCCCTCGGCTCAACCGAGGAACTGCGCTCCAAACCCCATGACTAGAGGGAGACAGAGGTAAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
beach0.416667
pacific ocean0.395604
haliotis sorenseni0.300000
white abalone0.300000
state of california0.264706
sand0.235294
depth 500-1000m0.222222
oil seep0.222222
state of oregon0.181818
hawaii0.181818
LOWER IN sea water0.181818
ocean0.164384
sea water0.153846
LOWER IN water0.133333
water0.127660
shell0.125000
bodega bay0.125000
santa cruz county0.125000
polymetallic nodule0.125000
san francisco bay0.125000
santa cruz province0.125000
LOWER IN air0.125000
aquarium0.117647
depth 4000m0.117647
LOWER IN marine sediment0.117647
egg0.111111
sediment0.080000
ocean water0.076923
research facility0.041841
united states of america0.036320
feces0.010811
Fraction of dbbact annotations with this term covered by the query
TermScore
depth 500-1000m0.500000
oil seep0.500000
haliotis sorenseni0.500000
white abalone0.500000
shell0.500000
bodega bay0.500000
beach0.500000
santa cruz county0.500000
polymetallic nodule0.500000
san francisco bay0.500000
santa cruz province0.500000
LOWER IN air0.500000
aquarium0.333333
depth 4000m0.333333
LOWER IN marine sediment0.333333
pacific ocean0.285714
state of oregon0.250000
hawaii0.250000
egg0.250000
LOWER IN sea water0.250000
sand0.200000
state of california0.166667
sea water0.166667
ocean0.133333
LOWER IN water0.125000
water0.090909
ocean water0.083333
sediment0.055556
research facility0.022222
united states of america0.018634
feces0.005848
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.714286
pacific ocean0.642857
state of california0.642857
research facility0.357143
beach0.357143
sand0.285714
ocean0.214286
haliotis sorenseni0.214286
white abalone0.214286
water0.214286
sediment0.142857
carbonate0.142857
lithified carbonate blocks0.142857
depth 500-1000m0.142857
hydrate ridge0.142857
state of oregon0.142857
oil seep0.142857
active methane seep0.142857
hawaii0.142857
pearl harbor0.142857
hydroides elegans0.142857
tubeworm0.142857
sea water0.142857
LOWER IN water0.142857
LOWER IN sea water0.142857
egg0.071429
feces0.071429
shell0.071429
LOWER IN low activity methane seep0.071429
tubeworm tube0.071429
aquarium0.071429
ocean water0.071429
bodega bay0.071429
santa cruz county0.071429
depth 4000m0.071429
polymetallic nodule0.071429
LOWER IN marine sediment0.071429
san francisco bay0.071429
santa cruz province0.071429
LOWER IN air0.071429
Exp. ID User ID Description Date Sequences
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, oil seep, active methane seep2019-02-191 / 163
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-131 / 243
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-301 / 609
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-301 / 632
486amnon high in oil seep active methane seep compared to low activity methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-191 / 649
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-301 / 727
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-071 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-121 / 1425
139amnon high in polymetallic nodule compared to marine sediment in pacific ocean depth 4000m 2017-04-181 / 1483
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-121 / 1599
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070

Problems / suggestions? Please email info AT dbbact DOT org