Search result for sequence:
CACGAACCGGACAAACGTTATTCGGAATTATTGGGCTTAAAGGGTGTGTAGGCGGTCATGTAGGTGGGGTGTGAAATCCCTCGGCTCAACCGAGGAACTGCGCTCCAAACCCCATGACTAGAGGGAGACAGAGGTAAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
beach0.416667
pacific ocean0.344498
haliotis sorenseni0.300000
white abalone0.300000
state of california0.243243
sand0.235294
carbonate0.222222
lithified carbonate blocks0.222222
hydrate ridge0.222222
active methane seep0.222222
pearl harbor0.222222
hydroides elegans0.222222
tubeworm0.222222
depth 500-1000m0.200000
oil seep0.200000
state of oregon0.166667
hawaii0.166667
LOWER IN sea water0.166667
ocean0.157895
sea water0.142857
shell0.125000
LOWER IN low activity methane seep0.125000
tubeworm tube0.125000
bodega bay0.125000
santa cruz county0.125000
polymetallic nodule0.125000
san francisco bay0.125000
santa cruz province0.125000
LOWER IN air0.125000
aquarium0.117647
depth 4000m0.117647
LOWER IN marine sediment0.111111
LOWER IN water0.111111
egg0.105263
water0.103448
sediment0.066667
ocean water0.064516
research facility0.039761
united states of america0.033296
feces0.010000
Fraction of dbbact annotations with this term covered by the query
TermScore
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
active methane seep0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
haliotis sorenseni0.500000
white abalone0.500000
shell0.500000
LOWER IN low activity methane seep0.500000
tubeworm tube0.500000
bodega bay0.500000
beach0.500000
santa cruz county0.500000
polymetallic nodule0.500000
san francisco bay0.500000
santa cruz province0.500000
LOWER IN air0.500000
depth 500-1000m0.333333
oil seep0.333333
aquarium0.333333
depth 4000m0.333333
LOWER IN marine sediment0.250000
pacific ocean0.235294
state of oregon0.200000
hawaii0.200000
egg0.200000
sand0.200000
LOWER IN sea water0.200000
state of california0.150000
sea water0.142857
ocean0.125000
LOWER IN water0.090909
water0.068182
ocean water0.058824
sediment0.043478
research facility0.021053
united states of america0.017045
feces0.005376
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.714286
pacific ocean0.642857
state of california0.642857
research facility0.357143
beach0.357143
sand0.285714
ocean0.214286
haliotis sorenseni0.214286
white abalone0.214286
water0.214286
sediment0.142857
carbonate0.142857
lithified carbonate blocks0.142857
depth 500-1000m0.142857
hydrate ridge0.142857
state of oregon0.142857
oil seep0.142857
active methane seep0.142857
hawaii0.142857
pearl harbor0.142857
hydroides elegans0.142857
tubeworm0.142857
sea water0.142857
LOWER IN water0.142857
LOWER IN sea water0.142857
egg0.071429
feces0.071429
shell0.071429
LOWER IN low activity methane seep0.071429
tubeworm tube0.071429
aquarium0.071429
ocean water0.071429
bodega bay0.071429
santa cruz county0.071429
depth 4000m0.071429
polymetallic nodule0.071429
LOWER IN marine sediment0.071429
san francisco bay0.071429
santa cruz province0.071429
LOWER IN air0.071429
Exp. ID User ID Description Date Sequences
486amnoncommon pacific ocean, ocean, sediment, carbonate, lithified carbonate blocks, depth 500-1000m, hydrate ridge, state of oregon, oil seep, active methane seep2019-02-191 / 163
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-131 / 243
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-301 / 609
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-301 / 632
486amnon high in oil seep active methane seep compared to low activity methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-191 / 649
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-301 / 727
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-071 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-121 / 1425
139amnon high in polymetallic nodule compared to marine sediment in pacific ocean depth 4000m 2017-04-181 / 1483
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-121 / 1599
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070

Problems / suggestions? Please email info AT dbbact DOT org