Search result for sequence:
CACGAACCGGACGAACGTTATTCGGAATCATTGGGCTTAAAGGGTGCGTAGGCGGCTATGTAGGTGGGGTGTGAAATCCCTCGGCTCAACCGAGGAACTGCGCCCCAAACCACATGGCTAGAGGGAGACAGAGGTAAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
hawaii0.400000
research facility0.021978
united states of america0.012346
Fraction of dbbact annotations with this term covered by the query
TermScore
hawaii0.250000
research facility0.011111
united states of america0.006211
Fraction of annotations for the query sequences containing the term
TermScore
hawaii1.000000
pearl harbor1.000000
research facility1.000000
hydroides elegans1.000000
tubeworm1.000000
united states of america1.000000
tubeworm tube1.000000

Problems / suggestions? Please email info AT dbbact DOT org