Search result for sequence:
CACGAACCGTACGAACGTTATTCGGAATCACTGGGCTTAAAGAGTGCGTAGGCGGCTTTACAGGTGGGGTGTGAAAGCCCACGGCTCAACCGTGGAACTGCGCCCCAAACCGTAAGGCTTGAGGGAGATAGAGGTGAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
hawaii0.666667
shore0.500000
marine sediment0.142857
research facility0.021739
united states of america0.012270
Fraction of dbbact annotations with this term covered by the query
TermScore
hawaii0.500000
shore0.500000
marine sediment0.083333
research facility0.011111
united states of america0.006211
Fraction of annotations for the query sequences containing the term
TermScore
hawaii1.000000
pearl harbor0.500000
research facility0.500000
hydroides elegans0.500000
tubeworm0.500000
united states of america0.500000
tubeworm tube0.500000
shore0.500000
marine sediment0.500000

Problems / suggestions? Please email info AT dbbact DOT org