Search result for sequence:
CACGAACCGTACGAACGTTATTCGGAATCACTGGGCTTAAAGAGTGCGTAGGCGGCTTTACAGGTGGGGTGTGAAAGCCCACGGCTCAACCGTGGAACTGCGCCCCAAACCGTAAGGCTTGAGGGAGATAGAGGTGAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
hawaii0.571429
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
shore0.500000
marine sediment0.133333
research facility0.020619
united states of america0.011236
Fraction of dbbact annotations with this term covered by the query
TermScore
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
shore0.500000
hawaii0.400000
marine sediment0.076923
research facility0.010526
united states of america0.005682
Fraction of annotations for the query sequences containing the term
TermScore
hawaii1.000000
pearl harbor0.500000
research facility0.500000
hydroides elegans0.500000
tubeworm0.500000
united states of america0.500000
tubeworm tube0.500000
shore0.500000
marine sediment0.500000

Problems / suggestions? Please email info AT dbbact DOT org