Search result for sequence:
CACGAACTGCGCGAACGTTATTCGGAATCACTGGGCTTAAAGAGTTCGTAGGCGGCTTGGTCAGTCAGATGTGAAATCCCACAGCCCAACTGTGGAACTGCGTTTGATACTGCCAAGCTTGAGGGAGTTAGAGGAAAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
beach0.480000
hawaii0.392157
pearl harbor0.315789
hydroides elegans0.315789
tubeworm0.315789
sand0.263158
shore0.235294
san francisco bay0.235294
LOWER IN sea water0.173913
sea water0.148148
tubeworm tube0.133333
south florida0.133333
LOWER IN shark0.133333
santa cruz province0.133333
LOWER IN air0.133333
coral reef0.125000
depth 0m0.125000
monterey bay0.125000
LOWER IN water0.114286
egg0.111111
state of florida0.105263
pacific ocean0.104348
atlantic ocean0.100000
surface water0.095238
state of california0.090226
marine sediment0.076923
water0.070175
ocean0.068966
ocean water0.066667
sediment0.055556
united states of america0.033352
adult0.025641
research facility0.020134
Fraction of dbbact annotations with this term covered by the query
TermScore
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
shore0.500000
tubeworm tube0.500000
south florida0.500000
LOWER IN shark0.500000
beach0.500000
san francisco bay0.500000
santa cruz province0.500000
LOWER IN air0.500000
hawaii0.400000
coral reef0.333333
depth 0m0.333333
monterey bay0.333333
egg0.200000
sand0.200000
LOWER IN sea water0.200000
state of florida0.166667
sea water0.142857
atlantic ocean0.142857
surface water0.125000
LOWER IN water0.090909
marine sediment0.076923
ocean0.062500
ocean water0.058824
pacific ocean0.058824
state of california0.050000
water0.045455
sediment0.043478
united states of america0.017045
adult0.015385
research facility0.010526
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.769231
state of california0.461538
beach0.461538
pacific ocean0.461538
hawaii0.384615
sand0.384615
pearl harbor0.230769
research facility0.230769
hydroides elegans0.230769
tubeworm0.230769
sea water0.153846
shore0.153846
water0.153846
san francisco bay0.153846
LOWER IN water0.153846
LOWER IN sea water0.153846
adult0.076923
ocean0.076923
sediment0.076923
coral reef0.076923
egg0.076923
tubeworm tube0.076923
atlantic ocean0.076923
south florida0.076923
state of florida0.076923
ocean water0.076923
surface water0.076923
depth 0m0.076923
LOWER IN shark0.076923
monterey bay0.076923
marine sediment0.076923
santa cruz province0.076923
LOWER IN air0.076923
Exp. ID User ID Description Date Sequences
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-131 / 80
418amnoncommon ocean, sediment, coral reef2018-12-021 / 216
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-131 / 243
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-121 / 345
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
323amnonlower in sharks compared to sea water ( high in water ocean water surface water depth 0m compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-241 / 979
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-121 / 1038
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-121 / 1151
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-121 / 1166
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-121 / 1599
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070

Problems / suggestions? Please email info AT dbbact DOT org