Search result for sequence:
CACGAACTGCGCGAACGTTATTCGGAATCACTGGGCTTAAAGAGTTCGTAGGCGGCTTGGTCAGTCAGATGTGAAATCCCACAGCCCAACTGTGGAACTGCGTTTGATACTGCCAAGCTTGAGGGAGTTAGAGGAAAGCGGAACTGATGG
common ontology terms
term enrichment score
TermScore
beach0.480000
hawaii0.434783
sand0.263158
shore0.235294
san francisco bay0.235294
LOWER IN sea water0.190476
sea water0.160000
LOWER IN water0.137931
south florida0.133333
depth 0m0.133333
LOWER IN shark0.133333
santa cruz province0.133333
LOWER IN air0.133333
coral reef0.125000
monterey bay0.125000
pacific ocean0.123711
egg0.117647
state of florida0.105263
surface water0.105263
atlantic ocean0.100000
state of california0.099174
water0.086957
ocean water0.080000
marine sediment0.080000
ocean0.071429
sediment0.064516
united states of america0.036386
adult0.028169
research facility0.021201
Fraction of dbbact annotations with this term covered by the query
TermScore
hawaii0.500000
shore0.500000
south florida0.500000
depth 0m0.500000
LOWER IN shark0.500000
beach0.500000
san francisco bay0.500000
santa cruz province0.500000
LOWER IN air0.500000
coral reef0.333333
monterey bay0.333333
egg0.250000
LOWER IN sea water0.250000
sand0.200000
sea water0.166667
state of florida0.166667
surface water0.166667
atlantic ocean0.142857
LOWER IN water0.125000
ocean water0.083333
marine sediment0.083333
pacific ocean0.071429
ocean0.066667
water0.060606
sediment0.055556
state of california0.055556
united states of america0.018634
adult0.017241
research facility0.011111
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.769231
state of california0.461538
beach0.461538
pacific ocean0.461538
hawaii0.384615
sand0.384615
pearl harbor0.230769
research facility0.230769
hydroides elegans0.230769
tubeworm0.230769
sea water0.153846
shore0.153846
water0.153846
san francisco bay0.153846
LOWER IN water0.153846
LOWER IN sea water0.153846
adult0.076923
ocean0.076923
sediment0.076923
coral reef0.076923
egg0.076923
tubeworm tube0.076923
atlantic ocean0.076923
south florida0.076923
state of florida0.076923
ocean water0.076923
surface water0.076923
depth 0m0.076923
LOWER IN shark0.076923
monterey bay0.076923
marine sediment0.076923
santa cruz province0.076923
LOWER IN air0.076923
Exp. ID User ID Description Date Sequences
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-131 / 80
418amnoncommon ocean, sediment, coral reef2018-12-021 / 216
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-131 / 243
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-121 / 345
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
323amnonlower in sharks compared to sea water ( high in water ocean water surface water depth 0m compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-241 / 979
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, monterey bay2018-03-121 / 1038
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-121 / 1151
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-121 / 1166
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-121 / 1599
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, san francisco bay2018-03-121 / 1799
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070

Problems / suggestions? Please email info AT dbbact DOT org