Search result for sequence:
CACGTAAGGCGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCGTGTAGGCGGCCGCATAAGTCGGGAGTGAAAGGCGCGGGCTCAACCCGCGGACTGCTCCCGATACTGTGCGGCTCGAGTCCCCGTGGCGCGGCCGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
zoological garden0.380952
rumen0.366492
rhesus macaque0.230769
captive0.222222
bos taurus0.214286
black rhinoceros0.173913
diceros bicornis0.173913
ovis aries0.171429
macaca mulatta0.171429
saint louis zoo0.166667
saint louis0.166667
camel0.166667
camelus dromedarius0.166667
holstein-friesian bull0.166667
mongolian sheep0.166667
colon0.166667
LOWER IN nouabale-ndoki national park0.166667
LOWER IN republic of congo0.166667
ireland0.142857
gorilla gorilla0.133333
egypt0.133333
monkey0.127660
rectum0.100000
LOWER IN wild0.100000
ileum0.095238
fresh clover diet0.090909
LOWER IN clover hay diet0.090909
660 days0.090909
LOWER IN 605 days0.090909
loxodonta africana0.090909
african elephant0.090909
dicerorhinus sumatrensis0.090909
sumatran rhinoceros0.090909
cecum0.090909
LOWER IN state of california0.090909
LOWER IN age 8 months0.090909
LOWER IN age 6 months0.090909
age 8 months0.090909
LOWER IN pan troglodytes troglodytes0.090909
gorilla gorilla gorilla0.090909
LOWER IN rumen0.086957
qinghai province0.086957
rumen liquid0.086957
state of nebraska0.083333
LOWER IN ruminant reticulum0.083333
LOWER IN omasum0.083333
lamb0.083333
LOWER IN age 3 months0.083333
pan troglodytes0.083333
chimpanzee0.083333
state of tennessee0.080000
caecum0.080000
age < 1 year0.076923
state of oregon0.076923
switzerland0.074074
sheep0.071429
cow0.068966
sweden0.064516
united states of america0.054299
age0.048780
feces0.039049
female0.035714
adult0.032787
research facility0.032258
china0.031915
Fraction of dbbact annotations with this term covered by the query
TermScore
black rhinoceros0.666667
diceros bicornis0.666667
saint louis zoo0.500000
saint louis0.500000
camel0.500000
camelus dromedarius0.500000
fresh clover diet0.500000
LOWER IN clover hay diet0.500000
holstein-friesian bull0.500000
660 days0.500000
LOWER IN 605 days0.500000
loxodonta africana0.500000
african elephant0.500000
dicerorhinus sumatrensis0.500000
sumatran rhinoceros0.500000
mongolian sheep0.500000
cecum0.500000
colon0.500000
LOWER IN state of california0.500000
rhesus macaque0.500000
LOWER IN age 8 months0.500000
LOWER IN age 6 months0.500000
age 8 months0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
gorilla gorilla gorilla0.500000
rumen0.384615
zoological garden0.363636
LOWER IN rumen0.333333
qinghai province0.333333
rumen liquid0.333333
ireland0.250000
state of nebraska0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
lamb0.250000
LOWER IN age 3 months0.250000
pan troglodytes0.250000
chimpanzee0.250000
bos taurus0.230769
gorilla gorilla0.200000
egypt0.200000
state of tennessee0.200000
captive0.200000
ovis aries0.200000
caecum0.200000
macaca mulatta0.200000
age < 1 year0.166667
state of oregon0.166667
switzerland0.142857
sheep0.125000
cow0.111111
monkey0.111111
rectum0.100000
LOWER IN wild0.100000
ileum0.090909
sweden0.090909
age0.047619
united states of america0.028436
female0.021739
feces0.020243
adult0.017857
china0.017857
research facility0.017544
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.600000
feces0.550000
zoological garden0.400000
rumen0.350000
captive0.250000
adult0.200000
bos taurus0.200000
research facility0.200000
ovis aries0.150000
china0.150000
monkey0.150000
rhesus macaque0.150000
macaca mulatta0.150000
saint louis zoo0.100000
saint louis0.100000
gorilla gorilla0.100000
egypt0.100000
camel0.100000
camelus dromedarius0.100000
holstein-friesian bull0.100000
ireland0.100000
mongolian sheep0.100000
rectum0.100000
ileum0.100000
colon0.100000
black rhinoceros0.100000
diceros bicornis0.100000
female0.100000
LOWER IN nouabale-ndoki national park0.100000
LOWER IN republic of congo0.100000
LOWER IN wild0.100000
fresh clover diet0.050000
LOWER IN clover hay diet0.050000
age0.050000
660 days0.050000
LOWER IN 605 days0.050000
loxodonta africana0.050000
african elephant0.050000
state of tennessee0.050000
cow0.050000
state of nebraska0.050000
dicerorhinus sumatrensis0.050000
sumatran rhinoceros0.050000
cecum0.050000
caecum0.050000
LOWER IN rumen0.050000
LOWER IN ruminant reticulum0.050000
LOWER IN omasum0.050000
qinghai province0.050000
rumen liquid0.050000
age < 1 year0.050000
lamb0.050000
sheep0.050000
LOWER IN state of california0.050000
state of oregon0.050000
switzerland0.050000
LOWER IN age 8 months0.050000
LOWER IN age 6 months0.050000
LOWER IN age 3 months0.050000
age 8 months0.050000
LOWER IN pan troglodytes troglodytes0.050000
pan troglodytes0.050000
chimpanzee0.050000
gorilla gorilla gorilla0.050000
sweden0.050000
Exp. ID User ID Description Date Region Flag Sequences
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 7
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 135
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 247
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 251
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 265
559amnoncommon feces, united states of america, captive, zoological garden, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 266
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 329
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 369
559amnoncommon feces, united states of america, black rhinoceros, diceros bicornis, captive, zoological garden2019-11-03v4No1 / 381
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 463
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 516
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 529
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
406amnoncommon feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 599
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 756
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 963
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1018
82amnoncommon in dairy cow rumen fluid (common bos taurus, sweden, rumen)2017-03-05v4No1 / 1321

Problems / suggestions? Please email info AT dbbact DOT org