Search result for sequence:
CACGTAAGGTGCGAGCGTTATTCGGAATTATTGGGCGTAAAGGGCACGCAGGCGGCTTTGCAAGCTTGGTGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTGAGAACTGCATGGCTAGAGTTAGTGAGGGGAAACCGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
zoological garden0.413793
macaca mulatta0.336000
pig0.293454
sus scrofa0.293454
monkey0.285714
rhesus macaque0.285714
captive0.208000
caecum0.195349
gorilla gorilla0.177778
pan troglodytes0.166667
chimpanzee0.166667
canada0.121212
saint louis zoo0.117647
saint louis0.117647
feces0.105227
rumen0.103448
state of tennessee0.100000
united kingdom0.095238
papio anubis0.093023
farm0.092308
central america0.090909
lincoln park zoo0.090909
hunter gatherer0.090909
ascending colon0.090909
province of alberta0.090909
ireland0.090909
LOWER IN state of california0.090909
como zoo0.090909
age 8 months0.090909
chicago0.086957
male organism0.086957
age 6 weeks0.080000
ovis aries0.080000
LOWER IN wild0.080000
rural community0.080000
ileum0.078431
state of oregon0.076923
state of minnesota0.076923
bos taurus0.075472
diet0.071429
male0.068966
olive baboon0.063492
macaque0.063492
hadza0.062500
jinhua city prefecture0.062500
jinhua pig0.062500
weaned0.062500
age 4-7 weeks0.062500
corn and soybean diet0.062500
mongolian sheep0.062500
colon0.062500
chuquisaca department0.062500
holstein-friesian bull0.062500
LOWER IN nouabale-ndoki national park0.062500
LOWER IN republic of congo0.062500
united states of america0.062347
child0.061538
alouatta palliata0.060606
mantled howler monkey0.060606
tanzania0.060606
age 5-13 years0.060606
LOWER IN mouth mucosa0.060606
LOWER IN city0.059701
age 6 months0.058824
jiangxi province0.058824
left colon0.058824
bolivia0.058824
LOWER IN united states of america0.057971
state of florida0.057143
age 3 months0.057143
right colon0.057143
LOWER IN ileum0.056338
LOWER IN mouth0.054054
rectum0.050000
research facility0.047904
skin0.044944
china0.042254
homo sapiens0.033473
female0.032787
camp hukamako0.032258
LOWER IN camp sengeli0.032258
corn diet0.032258
40mdgs diet0.032258
LOWER IN 27cds diet0.032258
LOWER IN 55cs diet0.032258
salmonellosis0.032258
salmonella enterica subsp. enterica serovar typhimurium0.032258
intestinal contents0.032258
age 100 days0.032258
farm 20.032258
LOWER IN farm 10.032258
white-faced saki0.032258
pithecia pithecia0.032258
sucram0.032258
LOWER IN standard feed0.032258
gorilla0.032258
black-handed spider monkey0.032258
ateles geoffroyi0.032258
dry forest0.032258
LOWER IN tropical moist broadleaf forest biome0.032258
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.800000
canada0.666667
papio anubis0.666667
olive baboon0.666667
macaque0.666667
macaca mulatta0.600000
caecum0.600000
zoological garden0.545455
saint louis zoo0.500000
saint louis0.500000
central america0.500000
pan troglodytes0.500000
chimpanzee0.500000
rhesus macaque0.500000
lincoln park zoo0.500000
hadza0.500000
hunter gatherer0.500000
camp hukamako0.500000
LOWER IN camp sengeli0.500000
corn diet0.500000
40mdgs diet0.500000
LOWER IN 27cds diet0.500000
LOWER IN 55cs diet0.500000
ascending colon0.500000
salmonellosis0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
province of alberta0.500000
intestinal contents0.500000
ireland0.500000
age 100 days0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 20.500000
LOWER IN farm 10.500000
LOWER IN state of california0.500000
como zoo0.500000
white-faced saki0.500000
pithecia pithecia0.500000
sucram0.500000
LOWER IN standard feed0.500000
age 8 months0.500000
gorilla0.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
mongolian sheep0.500000
cecum0.500000
colon0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
toronto zoo0.500000
alouatta pigra0.500000
howler monkey0.500000
tropical moist broadleaf forest biome0.500000
LOWER IN dry forest0.500000
tunapuco0.500000
LOWER IN state of oklahoma0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN age 1 month0.500000
chuquisaca department0.500000
holstein-friesian bull0.500000
LOWER IN age 8 months0.500000
LOWER IN age 6 months0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
LOWER IN restricted diet0.500000
pig0.454545
sus scrofa0.454545
alouatta palliata0.333333
mantled howler monkey0.333333
monkey0.333333
chicago0.333333
tanzania0.333333
male organism0.333333
LOWER IN mucosa0.333333
age 1 month0.333333
amerindian0.333333
venezuela0.333333
LOWER IN rumen0.333333
peru0.333333
age 5-13 years0.333333
LOWER IN mouth mucosa0.333333
arm0.333333
LOWER IN city0.285714
age 6 months0.250000
state of nebraska0.250000
lamb0.250000
jiangxi province0.250000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.733333
united states of america0.516667
zoological garden0.333333
research facility0.266667
monkey0.250000
macaca mulatta0.233333
captive0.216667
pig0.216667
sus scrofa0.216667
rhesus macaque0.200000
caecum0.116667
gorilla gorilla0.100000
pan troglodytes0.100000
chimpanzee0.100000
homo sapiens0.100000
china0.100000
adult0.083333
united kingdom0.083333
farm0.083333
saint louis zoo0.066667
saint louis0.066667
female0.066667
rumen0.066667
canada0.066667
state of tennessee0.066667
central america0.050000
state of florida0.050000
lincoln park zoo0.050000
chicago0.050000
hunter gatherer0.050000
bos taurus0.050000
diet0.050000
ascending colon0.050000
age 6 weeks0.050000
male0.050000
male organism0.050000
province of alberta0.050000
ovis aries0.050000
child0.050000
ireland0.050000
LOWER IN state of california0.050000
state of oregon0.050000
control0.050000
state of minnesota0.050000
como zoo0.050000
age 8 months0.050000
papio anubis0.050000
ileum0.050000
LOWER IN wild0.050000
rural community0.050000
alouatta palliata0.033333
mantled howler monkey0.033333
age 6 months0.033333
tanzania0.033333
hadza0.033333
jinhua city prefecture0.033333
jinhua pig0.033333
age 3 months0.033333
LOWER IN ileum0.033333
jiangxi province0.033333
weaned0.033333
age 4-7 weeks0.033333
corn and soybean diet0.033333
olive baboon0.033333
mongolian sheep0.033333
rectum0.033333
colon0.033333
skin0.033333
macaque0.033333
LOWER IN city0.033333
LOWER IN united states of america0.033333
right colon0.033333
left colon0.033333
age 5-13 years0.033333
bolivia0.033333
chuquisaca department0.033333
LOWER IN mouth mucosa0.033333
LOWER IN mouth0.033333
holstein-friesian bull0.033333
LOWER IN nouabale-ndoki national park0.033333
LOWER IN republic of congo0.033333
camp hukamako0.016667
LOWER IN camp sengeli0.016667
cow0.016667
state of nebraska0.016667
corn diet0.016667
40mdgs diet0.016667
LOWER IN 27cds diet0.016667
LOWER IN 55cs diet0.016667
salmonellosis0.016667
salmonella enterica subsp. enterica serovar typhimurium0.016667
LOWER IN mucosa0.016667
intestinal contents0.016667
sheep0.016667
lamb0.016667
age 100 days0.016667
farm 20.016667
LOWER IN farm 10.016667
age 1 month0.016667
white-faced saki0.016667
Exp. ID User ID Description Date Region Flag Sequences
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 7
80amnondominant feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 8
620amnondominant saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 14
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 15
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 15
671amnondominant age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 18
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 34
261amnondiet dependent in cow rumen ( high in diet corn diet 40mdgs diet compared to 27cds diet 55cs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 82
673amnoncommon ascending colon, caecum, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 102
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 104
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 135
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
673amnoncommon control, ascending colon, caecum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 168
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 178
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 226
673amnon high in ascending colon caecum compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 238
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 255
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 287
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 291
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 292
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 313
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 318
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 329
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 357
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 363
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 367
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 379
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 383
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 394
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 403
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 406
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 422
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 432
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 442
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 451
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 463
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 468
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 489
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 529
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 680
671amnon high in age 3 months compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 739
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 751
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 756
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 963
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1013
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1018
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1022

Problems / suggestions? Please email info AT dbbact DOT org