Search result for sequence:
CACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTCTGGCAAGCTTGGTGTGAAAGCCCGGAGCTCAACTCCGGAACAGCATTGAGAACTACCAGGCTAGAATCACTGAGGGGGAACCGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
equus caballus0.387097
equus zebra0.285714
mountain zebra0.285714
LOWER IN equine grass sickness0.285714
diceros bicornis0.250000
black rhinoceros0.250000
horse0.235294
LOWER IN disease0.222222
switzerland0.181818
united kingdom0.173913
french republic0.166667
zoological garden0.160000
farm0.065574
feces0.025974
united states of america0.019512
control0.013937
Fraction of dbbact annotations with this term covered by the query
TermScore
equus zebra0.500000
mountain zebra0.500000
LOWER IN equine grass sickness0.500000
diceros bicornis0.333333
black rhinoceros0.333333
equus caballus0.285714
LOWER IN disease0.250000
horse0.166667
switzerland0.166667
french republic0.142857
united kingdom0.111111
zoological garden0.100000
farm0.035714
feces0.013158
united states of america0.010000
control0.007092
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
equus caballus0.600000
horse0.400000
farm0.400000
control0.400000
united kingdom0.400000
zoological garden0.400000
united states of america0.400000
french republic0.200000
equus zebra0.200000
mountain zebra0.200000
diceros bicornis0.200000
black rhinoceros0.200000
switzerland0.200000
LOWER IN equine grass sickness0.200000
LOWER IN disease0.200000

Problems / suggestions? Please email info AT dbbact DOT org