Search result for sequence:
CACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTCTGCAAGTCTGGTGTGAAATACCGGGGCTCAACCCCGGAACTGCGTTGGAAACTGCAGGACTTGAATCGCTGAGGGGCAGCCAGAATTCCAGG
common ontology terms
term enrichment score
TermScore
rumen0.622222
ovis aries0.375000
mongolian sheep0.285714
bos taurus0.285714
holstein-friesian bull0.285714
ireland0.222222
cecum0.210526
camel0.210526
camelus dromedarius0.210526
state of tennessee0.200000
sheep0.200000
pan troglodytes0.173913
chimpanzee0.173913
egypt0.160000
diet0.153846
zoological garden0.133333
ileum0.121212
rumen solids0.117647
LOWER IN rumen liquid0.117647
27cds diet0.117647
55cs diet0.117647
LOWER IN corn diet0.117647
LOWER IN 40mdgs diet0.117647
LOWER IN fresh clover diet0.117647
clover hay diet0.117647
restricted feed0.117647
LOWER IN normal feed0.117647
rectum0.114286
state of nebraska0.111111
ruminant reticulum0.111111
omasum0.111111
bos grunniens0.105263
cow0.086957
kingdom of norway0.086957
sweden0.080000
colon0.075472
china0.035242
united states of america0.019277
adult0.018957
LOWER IN control0.012903
feces0.008584
Fraction of dbbact annotations with this term covered by the query
TermScore
rumen0.583333
mongolian sheep0.500000
cecum0.500000
holstein-friesian bull0.500000
rumen solids0.500000
LOWER IN rumen liquid0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
restricted feed0.500000
LOWER IN normal feed0.500000
ovis aries0.428571
sheep0.400000
state of nebraska0.333333
ruminant reticulum0.333333
omasum0.333333
pan troglodytes0.250000
chimpanzee0.250000
bos taurus0.250000
ireland0.250000
bos grunniens0.250000
state of tennessee0.200000
egypt0.200000
cow0.125000
diet0.125000
kingdom of norway0.125000
ileum0.111111
rectum0.100000
zoological garden0.100000
sweden0.100000
colon0.052632
china0.018868
adult0.010204
united states of america0.010000
LOWER IN control0.007143
feces0.004386
Fraction of annotations for the query sequences containing the term
TermScore
rumen0.666667
ovis aries0.333333
bos taurus0.333333
china0.266667
united states of america0.266667
mongolian sheep0.200000
zoological garden0.200000
feces0.200000
state of tennessee0.200000
holstein-friesian bull0.200000
ireland0.200000
diet0.200000
rectum0.133333
ileum0.133333
cecum0.133333
colon0.133333
pan troglodytes0.133333
chimpanzee0.133333
egypt0.133333
camel0.133333
camelus dromedarius0.133333
adult0.133333
sheep0.133333
rumen solids0.066667
LOWER IN rumen liquid0.066667
cow0.066667
state of nebraska0.066667
27cds diet0.066667
55cs diet0.066667
LOWER IN corn diet0.066667
LOWER IN 40mdgs diet0.066667
ruminant reticulum0.066667
omasum0.066667
LOWER IN fresh clover diet0.066667
clover hay diet0.066667
kingdom of norway0.066667
bos grunniens0.066667
sweden0.066667
restricted feed0.066667
LOWER IN control0.066667
LOWER IN normal feed0.066667
Exp. ID User ID Description Date Region Flag Sequences
111amnondominant mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
399amnondominant pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 67
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 451
329amnoncommon ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 506
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
82amnoncommon in dairy cow rumen fluid (common bos taurus, sweden, rumen)2017-03-05v4No1 / 1322
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1735

Problems / suggestions? Please email info AT dbbact DOT org