Search result for sequence:
CACGTAGGATCCAAGCGTTATCCGAATTTACTGGGCGTAAAGCGCGTGCAGGCGGTTTAGTAAGTTGGATGTGAAAGCTCCTGGCTCAACTGGGAGAGGCCGTTCAATACTACTAGACTAGAGGACGGTAGAGGGAGGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
dongzhaigang national nature reserve0.571429
hainan autonomous prefecture0.500000
mangrove0.444444
mangrove swamp0.400000
danzhou xinyinggang nature reserve0.400000
rhizophora stylosa0.400000
kandelia candel0.400000
mudflat0.400000
depth 0-20cm0.250000
marine sediment0.133333
soil0.031250
china0.018692
Fraction of dbbact annotations with this term covered by the query
TermScore
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
mangrove swamp0.250000
depth 0-20cm0.142857
marine sediment0.071429
soil0.015873
china0.009434
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
soil1.000000
mangrove swamp1.000000
marine sediment1.000000
depth 0-20cm1.000000
hainan autonomous prefecture1.000000
mangrove0.666667
dongzhaigang national nature reserve0.666667
danzhou xinyinggang nature reserve0.333333
rhizophora stylosa0.333333
kandelia candel0.333333
mudflat0.333333

Problems / suggestions? Please email info AT dbbact DOT org