Search result for sequence:
CACGTAGGATCCGAGCGTTATCCGAATTCACTGGGCGTAAAGCGCGTGCAGGCGGTCCGGTAAGTTGGATGTGAAATCTCCCGGCTCAACTGGGAGAGGTCGTTCAATACTGTCGGACTAGAGGGCAGTAGAGGGAGGTGGAATTCCCGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
saline marsh0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
spartina alterniflora0.333333
low salinity0.333333
LOWER IN high salinity0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
mangrove swamp0.250000
depth 0-20cm0.142857
atlantic ocean0.125000
marine sediment0.071429
sediment0.043478
rhizosphere0.030303
soil0.015873
china0.009434
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
china0.750000
soil0.750000
mangrove swamp0.750000
marine sediment0.750000
depth 0-20cm0.750000
hainan autonomous prefecture0.750000
mangrove0.500000
dongzhaigang national nature reserve0.500000
rhizosphere0.250000
saline marsh0.250000
united states of america0.250000
atlantic ocean0.250000
sediment0.250000
spartina alterniflora0.250000
low salinity0.250000
LOWER IN high salinity0.250000
danzhou xinyinggang nature reserve0.250000
rhizophora stylosa0.250000
kandelia candel0.250000
mudflat0.250000

Problems / suggestions? Please email info AT dbbact DOT org