Search result for sequence:
CACGTAGGATTCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGTTTGGTAAGTTGGGTGTGAAAGCTCCGGGCTCAACCCGGAGAGGTCGCTCAATACTGCCAGACTCGAGGACGGTAGAGGGAGGTGGAATTCCGGG
common ontology terms
term enrichment score
TermScore
mangrove swamp0.666667
leizhou nature reserve0.500000
mangrove biome0.500000
spartina alterniflora0.400000
guangdong province0.400000
depth 0-20cm0.285714
marine sediment0.125000
rhizosphere0.068966
china0.040816
soil0.035714
Fraction of dbbact annotations with this term covered by the query
TermScore
leizhou nature reserve0.500000
mangrove biome0.500000
mangrove swamp0.500000
spartina alterniflora0.333333
guangdong province0.333333
depth 0-20cm0.200000
marine sediment0.071429
rhizosphere0.037037
china0.020833
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
mangrove swamp1.000000
china1.000000
spartina alterniflora0.500000
leizhou nature reserve0.500000
guangdong province0.500000
mangrove biome0.500000
depth 0-20cm0.500000
marine sediment0.500000
soil0.500000
rhizosphere0.500000

Problems / suggestions? Please email info AT dbbact DOT org