Search result for sequence:
CACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTTGCGTCCGCTGTGAAAACTCGGGGCTTAACCCCGAGCCTGCAGTGGATACGGGCAGACTAGAGGTAGGTAGGGGAGAATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
soil0.705882
rhizosphere0.311060
cultivated environment0.295503
china0.221169
depth 0-10cm0.217096
forest ecosystem0.208062
topsoil0.203390
paddy field soil0.155477
woodland area0.152493
brazil0.152493
oryza sativa0.141176
minas gerais state0.137931
campos rupestres0.137931
wheat0.129964
depth 0-20cm0.122034
peat soil0.117936
peatland0.115663
root0.109739
canada0.107969
citrus0.103321
north china plain0.087591
mexico0.085714
tree0.085714
agricultural feature0.080537
state of tennessee0.077419
ph 60.075472
triticum aestivum0.074074
state of idaho0.074074
heilongjiang province0.071429
farm0.070175
united states of america0.067511
wetland area0.061069
fen0.061069
temperate grassland biome0.060150
barbacenia macrantha0.060150
populus0.060150
ph 5-60.060150
vellozia epidendroides0.060150
orchard0.060150
yellow brown soil0.060150
nanjing city prefecture0.060150
winter0.055814
leaf0.049080
tundra0.046512
soybean0.046332
moist tropical forest0.045802
siberia0.045802
myrtillocactus geometrizans0.045802
opuntia robusta0.045802
ph>6, ph<6.50.045802
guanajuato0.045802
bon portage island0.045802
burrow0.045802
fragaria x ananassa0.045802
strawberry0.045802
tomato0.045802
glycine max0.045802
sphagnum bog0.044776
cactus0.044776
semi-arid0.044776
hunan province0.044776
province of quebec0.044776
LOWER IN root0.044776
LOWER IN rhizosphere0.043796
zhejiang province0.043796
greenhouse soil0.043796
solanum lycopersicum0.043796
desert0.041096
skin0.040000
state of florida0.036585
venezuela0.031250
amerindian0.031250
northeast china0.031250
subtropical broadleaf forest biome0.031008
depth 20cm0.031008
ph 4.50.031008
lichen0.031008
moss0.031008
hunter gatherer0.031008
ph 50.031008
maryland county0.031008
hani peatland0.031008
baekdudaegan0.031008
permafrost0.031008
oceanodroma leucorhoa0.031008
seabird0.031008
temperate woodland biome0.031008
temperate deciduos forest0.031008
park0.031008
central park0.031008
taxus0.031008
taxus mairei0.031008
depth 30-75cm0.031008
silt clay loam0.031008
red soil0.031008
cambisol0.031008
ph<50.031008
slit loam soil0.031008
depth 0-30cm0.031008
silt loam0.031008
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.500000
peat soil0.750000
cultivated environment0.750000
tundra0.750000
depth 0-10cm0.714286
soil0.692308
topsoil0.666667
wetland area0.666667
fen0.666667
venezuela0.666667
amerindian0.666667
citrus0.666667
paddy field soil0.666667
northeast china0.666667
ph 60.666667
soybean0.666667
wheat0.666667
peatland0.600000
oryza sativa0.600000
forest ecosystem0.555556
rhizosphere0.555556
moist tropical forest0.500000
subtropical broadleaf forest biome0.500000
temperate grassland biome0.500000
depth 20cm0.500000
siberia0.500000
ph 4.50.500000
lichen0.500000
moss0.500000
LOWER IN depth 60 cm0.500000
pond0.500000
remartinia0.500000
aeshnidae0.500000
dragonfly0.500000
ursus arctos0.500000
brown bear0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
stem endosphere0.500000
hunter gatherer0.500000
ph 50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph>6, ph<6.50.500000
maryland county0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
hani peatland0.500000
baekdudaegan0.500000
ph 5-60.500000
LOWER IN riganqiao peatland0.500000
LOWER IN tibetan plateau0.500000
LOWER IN ph 5.5-6.50.500000
permafrost0.500000
nenets autonomous okrug0.500000
mature soil0.500000
pinus siberica0.500000
pine forest0.500000
vellozia epidendroides0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
vero beach, fl0.500000
mediterranean forest biome0.500000
montane forest0.500000
orchard0.500000
savanna0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
park0.500000
central park0.500000
boreal wetland0.500000
seasonal frozen marsh0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN northeast china0.500000
LOWER IN temperate0.500000
reunion island0.500000
depth 30-75cm0.500000
silt clay loam0.500000
copper0.500000
yunnan province0.500000
red soil0.500000
cambisol0.500000
triticum aestivum0.500000
ph<50.500000
fragaria x ananassa0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.720000
china0.336000
rhizosphere0.216000
cultivated environment0.184000
united states of america0.160000
depth 0-10cm0.128000
forest ecosystem0.128000
topsoil0.120000
woodland area0.104000
brazil0.104000
paddy field soil0.088000
minas gerais state0.080000
campos rupestres0.080000
oryza sativa0.080000
depth 0-20cm0.072000
wheat0.072000
peatland0.064000
peat soil0.064000
root0.064000
citrus0.056000
canada0.056000
mexico0.048000
state of tennessee0.048000
tree0.048000
farm0.048000
north china plain0.048000
agricultural feature0.048000
winter0.048000
heilongjiang province0.040000
triticum aestivum0.040000
ph 60.040000
state of idaho0.040000
temperate grassland biome0.032000
wetland area0.032000
fen0.032000
barbacenia macrantha0.032000
leaf0.032000
populus0.032000
ph 5-60.032000
vellozia epidendroides0.032000
orchard0.032000
yellow brown soil0.032000
nanjing city prefecture0.032000
moist tropical forest0.024000
sphagnum bog0.024000
siberia0.024000
homo sapiens0.024000
skin0.024000
myrtillocactus geometrizans0.024000
opuntia robusta0.024000
cactus0.024000
semi-arid0.024000
ph>6, ph<6.50.024000
LOWER IN rhizosphere0.024000
tundra0.024000
desert0.024000
guanajuato0.024000
state of florida0.024000
bon portage island0.024000
burrow0.024000
zhejiang province0.024000
hunan province0.024000
fragaria x ananassa0.024000
strawberry0.024000
greenhouse soil0.024000
province of quebec0.024000
water0.024000
solanum lycopersicum0.024000
tomato0.024000
glycine max0.024000
soybean0.024000
LOWER IN root0.024000
guangdong province0.016000
subtropical broadleaf forest biome0.016000
depth 20cm0.016000
ph 4.50.016000
lichen0.016000
moss0.016000
stem0.016000
venezuela0.016000
amerindian0.016000
hunter gatherer0.016000
ph 50.016000
maryland county0.016000
hani peatland0.016000
baekdudaegan0.016000
permafrost0.016000
bird0.016000
oceanodroma leucorhoa0.016000
seabird0.016000
temperate woodland biome0.016000
temperate deciduos forest0.016000
urban biome0.016000
park0.016000
new york city0.016000
central park0.016000
northeast china0.016000
taxus0.016000
taxus mairei0.016000
australia0.016000
Exp. ID User ID Description Date Region Flag Sequences
357amnonhigh freq. in moist tropical forest topsoil around the world (highfreq soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 4
359amnonhighfreq soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 10
84amnonhighfreq soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 15
147amnonhighfreq peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 18
512amnon high in depth 10 cm compared to depth 60 cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
316amnoncommon united states of america, soil, topsoil, state of ohio, depth 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
129amnon high in soil compared to rhizosphere in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph>6, ph<6.5 2017-04-15v4No1 / 221
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
147amnoncommon tundra, soil, pinus siberica, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
135amnoncommon soil, tundra, alaska, permafrost, depth 15cm2017-04-17v4No1 / 438
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
357amnoncommon soil, topsoil, depth 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
357amnoncommon soil, topsoil, depth 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.52017-04-15v4No1 / 884
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.5, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
154amnon high in uranium high uranium compared to control in soil australia kakadu national park sediment 2017-06-29v4No1 / 1080
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
422amnon high in ph 5-6 compared to ph 7-8 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 1634
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org