Search result for sequence:
CACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTTGCGTCCGCTGTGAAAACTCGGGGCTTAACCCCGAGCCTGCAGTGGATACGGGCAGACTAGAGGTAGGTAGGGGAGAATGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
soil0.701169
rhizosphere0.318937
cultivated environment0.266409
china0.229124
depth 0-10cm0.216867
topsoil0.215311
forest ecosystem0.187354
brazil0.168421
depth 0-20cm0.141176
paddy field soil0.138801
woodland area0.138667
oryza sativa0.126050
minas gerais state0.123457
campos rupestres0.123457
ph 60.116883
wheat0.112500
peat soil0.104803
peatland0.103004
root0.096386
canada0.093960
citrus0.091803
zhejiang province0.085890
north china plain0.077922
mexico0.076433
tree0.076433
agricultural feature0.072289
united states of america0.071076
state of tennessee0.069767
sugarcane0.066890
saccharum0.066890
new york0.066890
depth 15cm0.065789
state of idaho0.065789
triticum aestivum0.064725
heilongjiang province0.063694
farm0.060606
wetland area0.054054
fen0.054054
temperate grassland biome0.053333
barbacenia macrantha0.053333
populus0.053333
ph 5-60.053333
vellozia epidendroides0.053333
orchard0.053333
coarse-loamy soil0.053333
yellow brown soil0.053333
nanjing city prefecture0.053333
quzhou county0.053333
days 1800.053333
mature barley plants0.053333
LOWER IN root0.052288
ph 4-50.051948
hordeum vulgare0.051948
winter0.051724
depth 0-5cm0.050633
leaf0.043956
tundra0.041096
soybean0.040956
moist tropical forest0.040541
siberia0.040541
myrtillocactus geometrizans0.040541
opuntia robusta0.040541
ph>6, ph<6.50.040541
guanajuato0.040541
bon portage island0.040541
burrow0.040541
campinas0.040541
fragaria x ananassa0.040541
strawberry0.040541
tomato0.040541
glycine max0.040541
bulk soil0.040541
day 820.040541
sphagnum bog0.039735
cactus0.039735
semi-arid0.039735
guangzhou city prefecture0.039735
greenhouse0.039735
hunan province0.039735
province of quebec0.039735
biochar0.039344
greenhouse soil0.038961
LOWER IN rhizosphere0.038462
solanum lycopersicum0.038217
desert0.036810
skin0.035503
state of florida0.032086
water0.027650
venezuela0.027586
amerindian0.027586
ph 4-60.027586
northeast china0.027586
subtropical broadleaf forest biome0.027397
depth 20cm0.027397
ph 4.50.027397
lichen0.027397
moss0.027397
hunter gatherer0.027397
ph 50.027397
elevation 2000-3000m0.027397
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
depth 0-10cm0.750000
peat soil0.750000
cultivated environment0.750000
tundra0.750000
ph 60.750000
topsoil0.714286
soil0.666667
wetland area0.666667
fen0.666667
venezuela0.666667
amerindian0.666667
ph 4-60.666667
sugarcane0.666667
saccharum0.666667
citrus0.666667
paddy field soil0.666667
northeast china0.666667
new york0.666667
soybean0.666667
peatland0.600000
oryza sativa0.600000
forest ecosystem0.555556
rhizosphere0.545455
moist tropical forest0.500000
subtropical broadleaf forest biome0.500000
temperate grassland biome0.500000
depth 20cm0.500000
siberia0.500000
ph 4.50.500000
lichen0.500000
moss0.500000
LOWER IN depth 60 cm0.500000
pond0.500000
remartinia0.500000
aeshnidae0.500000
dragonfly0.500000
ursus arctos0.500000
brown bear0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
hunter gatherer0.500000
ph 50.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph>6, ph<6.50.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
maryland county0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
hani peatland0.500000
baekdudaegan0.500000
ph 5-60.500000
ph 4.5-70.500000
canton of graubunden0.500000
LOWER IN riganqiao peatland0.500000
LOWER IN tibetan plateau0.500000
LOWER IN ph 5.5-6.50.500000
permafrost0.500000
nenets autonomous okrug0.500000
mature soil0.500000
pinus siberica0.500000
pine forest0.500000
vellozia epidendroides0.500000
guanajuato0.500000
depth 15cm0.500000
agave0.500000
agave salmiana0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
LOWER IN ph 5.5-60.500000
ph 6.70.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
vero beach, fl0.500000
mediterranean forest biome0.500000
montane forest0.500000
orchard0.500000
savanna0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
park0.500000
central park0.500000
boreal wetland0.500000
seasonal frozen marsh0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN northeast china0.500000
LOWER IN temperate0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.739437
china0.352113
rhizosphere0.225352
united states of america0.169014
cultivated environment0.161972
topsoil0.126761
depth 0-10cm0.126761
forest ecosystem0.112676
brazil0.112676
woodland area0.091549
depth 0-20cm0.084507
paddy field soil0.077465
minas gerais state0.070423
campos rupestres0.070423
oryza sativa0.070423
ph 60.063380
wheat0.063380
peatland0.056338
peat soil0.056338
root0.056338
citrus0.049296
canada0.049296
zhejiang province0.049296
mexico0.042254
state of tennessee0.042254
tree0.042254
farm0.042254
north china plain0.042254
agricultural feature0.042254
winter0.042254
depth 15cm0.035211
sugarcane0.035211
saccharum0.035211
heilongjiang province0.035211
new york0.035211
triticum aestivum0.035211
state of idaho0.035211
temperate grassland biome0.028169
wetland area0.028169
fen0.028169
barbacenia macrantha0.028169
leaf0.028169
populus0.028169
ph 5-60.028169
vellozia epidendroides0.028169
orchard0.028169
depth 0-5cm0.028169
coarse-loamy soil0.028169
yellow brown soil0.028169
nanjing city prefecture0.028169
LOWER IN root0.028169
quzhou county0.028169
ph 4-50.028169
hordeum vulgare0.028169
days 1800.028169
mature barley plants0.028169
moist tropical forest0.021127
sphagnum bog0.021127
siberia0.021127
homo sapiens0.021127
skin0.021127
myrtillocactus geometrizans0.021127
opuntia robusta0.021127
cactus0.021127
semi-arid0.021127
ph>6, ph<6.50.021127
LOWER IN rhizosphere0.021127
tundra0.021127
desert0.021127
guanajuato0.021127
guangzhou city prefecture0.021127
state of florida0.021127
bon portage island0.021127
burrow0.021127
campinas0.021127
greenhouse0.021127
hunan province0.021127
fragaria x ananassa0.021127
strawberry0.021127
greenhouse soil0.021127
province of quebec0.021127
water0.021127
solanum lycopersicum0.021127
tomato0.021127
glycine max0.021127
soybean0.021127
biochar0.021127
bulk soil0.021127
day 820.021127
guangdong province0.014085
subtropical broadleaf forest biome0.014085
depth 20cm0.014085
ph 4.50.014085
lichen0.014085
moss0.014085
stem0.014085
venezuela0.014085
amerindian0.014085
hunter gatherer0.014085
ph 50.014085
Exp. ID User ID Description Date Region Flag Sequences
357amnonhigh freq. in moist tropical forest topsoil around the world (dominant soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 4
359amnondominant soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 10
84amnondominant soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 15
147amnondominant peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 18
512amnon high in depth 10 cm compared to depth 60 cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
316amnoncommon united states of america, soil, topsoil, state of ohio, depth 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
129amnon high in soil compared to rhizosphere in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph>6, ph<6.5 2017-04-15v4No1 / 221
583amnoncommon soil, mountain, switzerland, ph 4-6, depth 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
583amnoncommon soil, mountain, switzerland, depth 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
147amnoncommon tundra, soil, pinus siberica, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
135amnoncommon soil, tundra, alaska, permafrost, depth 15cm2017-04-17v4No1 / 438
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in sugarcane saccharum soil topsoil depth 0-20cm china guangzhou city prefecture 2020-04-27v3No1 / 504
357amnoncommon soil, topsoil, depth 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
357amnoncommon soil, topsoil, depth 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
462amnoncommon united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in soil depth 0-5cm united states of america new york coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.52017-04-15v4No1 / 884
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
615amnon high in rhizosphere compared to endosphere root in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 913
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
359amnoncommon soil, topsoil, depth 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 938
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.5, root zone soil2017-04-15v4No1 / 968
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 997
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
154amnon high in uranium high uranium compared to control in soil australia kakadu national park sediment 2017-06-29v4No1 / 1080
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
616amnoncommon in topsoil of non-fertilized sugarcane field (common ph 6.7, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
600sheryoCommon in biochar ammended soil after 82 days (common soil, biochar, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common soil, depth 0-5cm, united states of america, new york, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
422amnon high in ph 5-6 compared to ph 7-8 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 1634
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, depth 0-20cm, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon soil, temperate grassland biome, fen, peat soil, flooded grassland biome, depth 5 cm, united kingdom2017-03-07v4No1 / 3434
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4853
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org