dbBact sequence annotation

×

Search result for sequence:

CACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGTGGTCTGTTGCGTCCGCTGTGAAAACTCGGGGCTTAACCCCGAGCCTGCAGTGGATACGGGCAGACTAGAGGTAGGTAGGGGAGAATGGAATTCCTGG

Taxonomy: dBacteria;p"Actinobacteria";cActinobacteria;oActinomycetales

species	# matches	SILVA IDs

common ontology terms

term enrichment score

Term	Score
minas gerais state	0.363636
campos rupestres	0.363636
barbacenia macrantha	0.363636
lu'an city prefecture	0.363636
flowerpot	0.363636
north china plain	0.222222
ph>4, ph<5	0.222222
moist tropical forest	0.222222
ph<4.5	0.222222
LOWER IN ph>4.5	0.222222
southern united states	0.222222
terrestrial snake	0.222222
LOWER IN aquatic snake	0.222222
dendrobium officinale	0.222222
dendrobium moniliforme	0.222222
greenhouse	0.210526
snake	0.200000
stem endosphere	0.200000
root endosphere	0.181818
wheat	0.166667
stem	0.142857
topsoil	0.125000
forest ecosystem	0.125000
woodland area	0.111111
depth (soil) 0-10cm	0.100000
agricultural feature	0.095238
root	0.090909
brazil	0.088889
winter	0.076923
skin	0.048780
depth (soil) 0-20cm	0.041667
rhizosphere	0.039604
soil	0.037037
china	0.021090
research facility	0.012085
united states of america	0.007519

Fraction of dbbact annotations with this term covered by the query

Term	Score
north china plain	0.500000
ph>4, ph<5	0.500000
moist tropical forest	0.500000
ph<4.5	0.500000
LOWER IN ph>4.5	0.500000
southern united states	0.500000
terrestrial snake	0.500000
LOWER IN aquatic snake	0.500000
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
lu'an city prefecture	0.500000
flowerpot	0.500000
dendrobium officinale	0.500000
dendrobium moniliforme	0.500000
snake	0.333333
stem endosphere	0.333333
root endosphere	0.250000
wheat	0.200000
greenhouse	0.166667
stem	0.142857
topsoil	0.111111
forest ecosystem	0.111111
woodland area	0.090909
depth (soil) 0-10cm	0.076923
agricultural feature	0.071429
root	0.066667
winter	0.052632
brazil	0.052632
skin	0.029412
depth (soil) 0-20cm	0.024390
rhizosphere	0.021277
soil	0.019802
china	0.010811
research facility	0.006173
united states of america	0.003861

Fraction of annotations for the query sequences containing the term

Term	Score
china	0.428571
soil	0.285714
minas gerais state	0.285714
campos rupestres	0.285714
brazil	0.285714
barbacenia macrantha	0.285714
lu'an city prefecture	0.285714
flowerpot	0.285714
research facility	0.285714
greenhouse	0.285714
rhizosphere	0.285714
depth (soil) 0-20cm	0.142857
north china plain	0.142857
agricultural feature	0.142857
wheat	0.142857
winter	0.142857
ph>4, ph<5	0.142857
topsoil	0.142857
depth (soil) 0-10cm	0.142857
moist tropical forest	0.142857
ph<4.5	0.142857
LOWER IN ph>4.5	0.142857
woodland area	0.142857
forest ecosystem	0.142857
snake	0.142857
skin	0.142857
united states of america	0.142857
southern united states	0.142857
terrestrial snake	0.142857
LOWER IN aquatic snake	0.142857
root endosphere	0.142857
root	0.142857
stem	0.142857
stem endosphere	0.142857
dendrobium officinale	0.142857
dendrobium moniliforme	0.142857

Exp. ID	User ID	Description	Date	Region	Flag	Sequences
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere	2019-08-17	v4	No	1 / 123
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root	2019-08-17	v4	No	1 / 575
536	amnon	high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states	2019-07-28	v4	No	1 / 590
809	amnon	common lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china	2021-06-20	v4	No	1 / 715
357	amnon	high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem	2018-08-18	v4	No	1 / 915
809	amnon	common dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china	2021-06-20	v4	No	1 / 1002
296	amnon	common depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china	2018-02-11	v4	No	1 / 1886

Problems / suggestions? Please email info AT dbbact DOT org