Search result for sequence:
CCTAGTAGATTAGATAGACCCGGCAATCGAAAGGTCCCTGGTTTGATTCCAGGCCCGGACTTGGTTGTAATTATCCAAATATTGTTTATACCTTTTAATAATATTACTTTGTGACTTTGTGGCTATTGAGCTTAATGACAAAAAAAACCT
common ontology terms
term enrichment score
TermScore
herbivorous beetle0.666667
poland0.500000
beetle0.500000
nida basin0.500000
argoptochus quadrisignatus0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
whole body0.400000
plant0.200000
Fraction of dbbact annotations with this term covered by the query
TermScore
nida basin0.500000
herbivorous beetle0.500000
argoptochus quadrisignatus0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
poland0.333333
beetle0.333333
whole body0.250000
plant0.125000
Fraction of annotations for the query sequences containing the term
TermScore
poland1.000000
whole body1.000000
beetle1.000000
herbivorous beetle1.000000
plant0.500000
nida basin0.500000
argoptochus quadrisignatus0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000

Problems / suggestions? Please email info AT dbbact DOT org