Search result for sequence:
GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
united states of america0.274977
soil0.166827
plant0.153772
state of michigan0.138829
skin0.135261
feces0.127581
state of california0.123570
research facility0.122511
china0.119743
leaf0.115129
kalamazoo loam0.098765
mesic type hapludalf0.098765
kellogg biological station0.098765
homo sapiens0.097655
farm0.095833
greenhouse0.089776
austria0.084112
air0.077419
oryza sativa0.070411
sus scrofa0.063685
pig0.063685
rhizosphere0.061810
foodon product type0.060759
mus musculus0.058348
ethiopia0.057946
state of rhode island0.056848
wild0.056791
food (fermented)0.055790
adult0.054826
canada0.053452
stem0.051502
sweden0.051151
mouse0.049929
bos taurus0.049080
saliva0.047868
duodenum0.047476
depth 0-5cm0.047368
bodega bay0.046997
monkey0.046452
tonsil0.046452
fish0.046130
equus caballus0.045918
ocean0.044944
topsoil0.044390
digestive system0.043332
mouth0.042730
paddy field soil0.042440
restored prairie0.041995
zostera marina0.041131
marine eelgrass0.041131
horse0.040302
cultivated environment0.040302
felis catus0.039900
root0.039506
state of north carolina0.039506
dust0.037284
corn0.037284
panicum virgatum0.036939
rice0.036939
bird0.036601
depth 25-50cm0.036269
LOWER IN feces0.036269
pair of nares0.035944
female0.035848
cow0.034696
LOWER IN control0.034632
rumen0.034008
state of texas0.033816
urban biome0.032172
venezuela0.032086
amerindian0.032086
hunter gatherer0.031830
ensete ventricosum0.031830
ethiopian banana0.031830
grazing exclusion0.031830
haplic calcisol0.031830
calci-orthic aridisol0.031830
ningxia province0.031830
yunwushan national natural grassland protection zone0.031830
state of mississippi0.031830
LOWER IN caecum0.031414
stomach0.030848
infant0.030472
depth 0-20cm0.029925
depth 0-10cm0.029703
kingdom of spain0.029630
cat0.029484
israel0.028846
female organism0.027460
building0.026846
arm0.026846
holstein dairy cow0.026846
nida basin0.026667
herbivorous beetle0.026667
continuous corn0.026667
nile tilapia0.026667
27-35 years of grazing exclusion0.026667
lushan mountain0.026667
beetle0.026316
depth 50-100m0.026316
Fraction of dbbact annotations with this term covered by the query
TermScore
ethiopia0.750000
urban biome0.750000
oncorhynchus mykiss0.750000
rainbow trout0.750000
allium cepa0.666667
dust0.666667
corn0.666667
fish feed0.666667
building0.666667
air0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
snake0.666667
day 00.666667
holstein dairy cow0.666667
paddy field soil0.666667
duodenum0.636364
plant0.625000
depth 0-5cm0.600000
plant cell0.500000
greenhouse0.500000
aloe arborescens0.500000
aloe0.500000
dracaena draco0.500000
dracaena fragrans0.500000
howea forsteriana0.500000
musa acuminate0.500000
dairy0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris quatuordecimpunctata0.500000
bodega bay0.500000
state of rhode island0.500000
ginger0.500000
onion0.500000
cleanroom0.500000
continuous corn0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
alpine bog0.500000
plant surface0.500000
panicum virgatum0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
geospiza difficilis0.500000
finch0.500000
sharp-beaked ground finch0.500000
camarhynchus parvulus0.500000
small tree finch0.500000
nile tilapia0.500000
cyprinus carpio0.500000
england0.500000
common carp0.500000
bedroom0.500000
rana luteiventris0.500000
columbia spotted frog0.500000
boston0.500000
train0.500000
size < 10um0.500000
clear day0.500000
age 6-10 weeks0.500000
pyrenees0.500000
ant0.500000
pseudomyrmex pallidus0.500000
liolaemus ruibali0.500000
hunter gatherer0.500000
dust storm0.500000
grassland0.500000
steppe0.500000
crioceris duodecimpunctata0.500000
calophya0.500000
ruellia terminalis0.500000
pantherophis obsoletus0.500000
southern united states0.500000
black rat snake0.500000
arboreal snake0.500000
scallion0.500000
interdigital region0.500000
anser0.500000
goose0.500000
greylag goose0.500000
tsuga dumosa0.500000
himalayan hemlock0.500000
lapland0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
kitchen0.500000
sink0.500000
tissue0.500000
acropora hyacinthus0.500000
tsuga chinensis0.500000
chinese hemlock0.500000
depth 6-7m0.500000
nephrolepis cordifolia0.500000
rem sleep behavior disorder0.500000
nasal wash0.500000
ensete ventricosum0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.410959
soil0.153425
feces0.142466
china0.112329
research facility0.109589
homo sapiens0.104110
plant0.087671
state of michigan0.087671
skin0.079452
state of california0.073973
leaf0.071233
farm0.063014
kalamazoo loam0.054795
mesic type hapludalf0.054795
kellogg biological station0.054795
austria0.049315
greenhouse0.049315
adult0.043836
air0.041096
sus scrofa0.038356
pig0.038356
rhizosphere0.038356
oryza sativa0.038356
mus musculus0.035616
foodon product type0.032877
canada0.032877
wild0.032877
state of rhode island0.030137
ethiopia0.030137
food (fermented)0.030137
mouse0.030137
saliva0.030137
ocean0.027397
stem0.027397
sweden0.027397
LOWER IN control0.027397
bos taurus0.027397
duodenum0.024658
bodega bay0.024658
monkey0.024658
digestive system0.024658
fish0.024658
tonsil0.024658
depth 0-5cm0.024658
equus caballus0.024658
mouth0.024658
topsoil0.024658
zostera marina0.021918
marine eelgrass0.021918
root0.021918
felis catus0.021918
female0.021918
state of north carolina0.021918
horse0.021918
paddy field soil0.021918
cultivated environment0.021918
restored prairie0.021918
dust0.019178
corn0.019178
panicum virgatum0.019178
depth 25-50cm0.019178
bird0.019178
state of texas0.019178
LOWER IN feces0.019178
pair of nares0.019178
rice0.019178
rumen0.019178
cow0.019178
caecum0.016438
urban biome0.016438
israel0.016438
kingdom of spain0.016438
stomach0.016438
venezuela0.016438
amerindian0.016438
hunter gatherer0.016438
cat0.016438
LOWER IN caecum0.016438
infant0.016438
ensete ventricosum0.016438
ethiopian banana0.016438
depth 0-10cm0.016438
grazing exclusion0.016438
haplic calcisol0.016438
calci-orthic aridisol0.016438
ningxia province0.016438
yunwushan national natural grassland protection zone0.016438
female organism0.016438
state of mississippi0.016438
depth 0-20cm0.016438
poland0.013699
whole body0.013699
beetle0.013699
nida basin0.013699
herbivorous beetle0.013699
sediment0.013699
depth 50-100m0.013699
continuous corn0.013699
oreochromis niloticus0.013699
nile tilapia0.013699
Exp. ID User ID Description Date Region Flag Sequences
311amnongarlic chloroplast (other chloroplast, garlic)2018-04-09v4No1 / 1
321amnonplant chloroplast (other plant cell, chloroplast, plant)2018-04-21v4No1 / 1
361amnondominant leaf, austria, plant, greenhouse, aloe arborescens, aloe2018-08-21v4No1 / 1
361amnondominant leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 1
361amnondominant leaf, austria, plant, greenhouse, dracaena fragrans2018-08-21v4No1 / 1
361amnondominant leaf, austria, plant, greenhouse, howea forsteriana2018-08-21v4No1 / 1
361amnondominant leaf, austria, plant, greenhouse, musa acuminate2018-08-21v4No1 / 1
363amnondominant dairy, duodenum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 3
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 3
74amnondominant united states of america, allium cepa, foodon product type2017-02-27v4No1 / 4
236amnondominant ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 4
311amnondominant united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 4
311amnondominant united states of america, allium cepa, state of rhode island, onion, foodon product type2018-04-09v4No1 / 4
74amnondominant united states of america, allium sativum, foodon product type2017-02-27v4No1 / 5
236amnondominant ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 5
308amnonhigh freq. in spacecraft assembly cleanroom floor (dominant united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 5
311amnondominant united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 6
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 6
130amnondominant peatland, sphagnum bog, leaf, austria, plant, alpine bog, plant surface2017-04-15v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 7
236amnondominant ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 8
274amnondominant feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 8
440amnoncommon feces, geospiza difficilis, galapagos islands, bird, finch, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnoncommon feces, galapagos islands, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
91amnondominant serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 9
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
74amnoncommon united states of america, allium sativum, foodon product type2017-02-27v4No1 / 10
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
396amnondominant digestive system, intestine, cyprinus carpio, england, fish, common carp2018-11-14v4No1 / 10
523amnondominant united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 10
647amnondominant in skin of columbia spotted frog (dominant united states of america, lake, skin, frog, state of montana, rana luteiventris, columbia spotted frog)2020-09-06v4No1 / 10
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
206amnonhigh freq. in air from israel particles <10um size (dominant air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
403amnondominant air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
71amnondominant research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 12
75amnondominant homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (dominant air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 12
279amnondominant grassland, steppe, leaf, stem, mongolia, china2018-01-24v4No1 / 12
515amnondominant poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v4No1 / 13
74amnoncommon united states of america, allium cepa, foodon product type2017-02-27v4No1 / 13
97amnoncommon adult, brazil, state of florida, calophya2017-04-01v4No1 / 13
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
501amnondominant nectar, costa rica, flower, ruellia terminalis2019-03-08v4No1 / 13
536amnondominant united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 13
647amnoncommon in skin of columbia spotted frog (common united states of america, lake, skin, frog, state of montana, rana luteiventris, columbia spotted frog)2020-09-06v4No1 / 13
158amnondominant united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 14
311amnondominant united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 15
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
432amnondominant united states of america, stem, state of north carolina, plant, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
511amnondominant kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 15
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
180amnondominant larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 17
199amnonhigh freq. in kitchen sink (dominant united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
418amnondominant ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 17
432amnondominant united states of america, stem, state of north carolina, plant, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
287amnondominant mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 18
361amnoncommon leaf, austria, plant, greenhouse, nephrolepis cordifolia2018-08-21v4No1 / 18
384amnondominant farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 18
607amnondominant homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 18
511amnondominant united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 19
539amnondominant ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 20
396amnoncommon digestive system, intestine, oncorhynchus mykiss, england, fish, rainbow trout2018-11-14v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
158amnoncommon united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 22
265amnonhigh freq. in tree leaves (dominant leaf, canada, province of quebec, tree)2017-12-11v4No1 / 22
311amnoncommon united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 22
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
198amnondominant united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 23
432amnondominant united states of america, stem, state of north carolina, plant, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
432amnondominant united states of america, stem, state of north carolina, plant, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 23
539amnondominant ethiopia, late timepoint, ensete ventricosum, ethiopian banana, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 23
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v4No1 / 24
13amnon high in stomach esophagus duodenum ileum mouth compared to feces rectum caecum colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
275amnoncommon skin, antarctica, antarctic peninsula, megaptera novaeangliae, humpback whale2018-01-16v4No1 / 26
311amnoncommon united states of america, allium cepa, state of rhode island, onion, foodon product type2018-04-09v4No1 / 26
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
81amnoncommon cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 30
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age age 24 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 32
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
361amnoncommon leaf, austria, plant, greenhouse, aloe arborescens, aloe2018-08-21v4No1 / 34
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
287amnoncommon mountain, snow field, depth 1-2m, japan2018-01-29v4No1 / 35
539amnoncommon ethiopia, early timepoint, ensete ventricosum, ethiopian banana, days 1-15, aerobic fermentation, food (fermented)2019-07-31v4No1 / 35
180amnoncommon adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
361amnoncommon leaf, austria, plant, greenhouse, musa acuminate2018-08-21v4No1 / 37
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 40
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
647amnoncommon united states of america, lake, water, state of montana, freshwater lake2020-09-06v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
59amnoncommon digestive system, trigona hyalinata2017-02-02v4No1 / 43
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays whole plant israel corn )2018-03-19v4No1 / 45
396amnoncommon digestive system, intestine, cyprinus carpio, england, fish, common carp2018-11-14v4No1 / 45
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in early timepoints day 0 compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
91amnoncommon serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
361amnoncommon leaf, austria, plant, greenhouse, musa paradisiaca2018-08-21v4No1 / 77
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
163amnoncommon stomach, ochotonidae, pika, ochotona dauurica, mongolia grassland, china2017-07-13v4No1 / 80
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 81
361amnoncommon leaf, austria, plant, greenhouse, beaucarnea recurvata2018-08-21v4No1 / 81
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 88
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, whole plant, israel, corn)2018-03-19v4No1 / 96
26amnoncommon united states of america, saliva, canis lupus familiaris, mouth2016-12-05v4No1 / 99
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
361amnoncommon leaf, austria, plant, greenhouse, dracaena fragrans2018-08-21v4No1 / 100
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
361amnoncommon leaf, austria, plant, greenhouse, malvaviscus penduliflorus2018-08-21v4No1 / 102
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
387amnon high in summer compared to winter in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
361amnoncommon leaf, austria, plant, greenhouse, aechmea eurycorymbus2018-08-21v4No1 / 117
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
581amnoncommon in red swamp crayfish grown in flooded rice field (common rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 122
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia late timepoint ensete ventricosum ethiopian banana days 30-60 anaerobic fermentation food (fermented) 2019-07-31v4No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-25v4No1 / 128
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
384amnoncommon farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 131
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
615amnon high in stem upper stem stem surface compared to leaf leaf surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 143
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
361amnoncommon leaf, austria, plant, greenhouse, dracaena marginata2018-08-21v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
361amnoncommon leaf, austria, plant, greenhouse, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 155
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
539amnoncommon ethiopia, late timepoint, ensete ventricosum, ethiopian banana, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
26amnoncommon united states of america, saliva, felis catus, mouth2016-12-05v4No1 / 163
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
396amnon high in cyprinus carpio common carp compared to oncorhynchus mykiss rainbow trout in digestive system intestine england fish 2018-11-14v4No1 / 184
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in feces south africa syncerus caffer caffer cape buffalo )2017-03-08v4No1 / 194
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
123amnon high in diet normal diet regular mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 209
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
699amnon high in kingdom of spain mediterranean sea italy compared to united states of america atlantic ocean brazil in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 216
265amnoncommon in tree leaves (common leaf, canada, province of quebec, tree)2017-12-11v4No1 / 226
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
167amnoncommon feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 260
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 265
261amnoncommon united states of america, rumen, bos taurus, state of nebraska, cow2017-12-10v4No1 / 266
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
78amnonhigher in younger gazelles ( high in age young age compared to old age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 268
361amnoncommon leaf, austria, plant, greenhouse, chlorophytum comosum2018-08-21v4No1 / 270
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 282
236amnon high in leaf compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 287
729amnon high in wild pan troglodytes troglodytes cameroon central chimpanzee compared to zoological garden captive europe pan troglodytes verus eastern chimpanzee in feces monkey 2021-01-05v3No1 / 288
423amnoncommon skin, ukraine, bank vole, myodes glareolus2018-12-05v4No1 / 291
824sheryoHigher in soil at 0-10cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in soil depth 0-10cm china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 294
331amnoncommon feces, ethiopia, monkey, theropithecus gelada2018-05-13v4No1 / 298
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 299
77amnon high in winter compared to summer in marine biome kelp forest australia algae 2017-02-28v4No1 / 303
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
687amnon high in low milk yield compared to high milk yield in research facility rumen bos taurus rumen liquid shandong province china holstein dairy cow 2028-03-09v4No1 / 375
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, depth 0-5cm, long island sound, sporobolus pumilus, saltmeadow cordgrass2021-05-16v4No1 / 382
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
748amnon high in holstein dairy cow compared to jersey cow in feces united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 407
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
781amnoncommon feces, kenya, wild, loxodonta africana, masai mara national park, elephant2021-04-28v4No1 / 419
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
781amnon high in aepyceros melampus impala compared to damaliscus lunatus tsessebe in feces kenya wild masai mara national park 2021-04-28v4No1 / 460
236amnoncommon ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 483
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cn compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
236amnoncommon ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 505
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, spartina alterniflora, topsoil, state of connecticut, depth 0-5cm, long island sound, sporobolus alterniflorus, smooth cordgrass2021-05-16v4No1 / 511
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
781amnoncommon feces, kenya, wild, masai mara national park, phacochoerus africanus, warthog2021-04-28v4No1 / 564
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 577
784amnon high in sporobolus pumilus saltmeadow cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut depth 0-5cm long island sound 2021-05-16v4No1 / 581
633amnoncommon feces, thailand, captive, elephas maximus, asian elephant2020-06-16v4No1 / 591
384amnon high in saliva oral cavity mouth compared to nasal cavity pair of nares in farm equus caballus canada horse 2018-10-22v4No1 / 604
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil water soilwater in canada province of quebec )2017-12-11v4No1 / 610
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 614
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 628
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, jersey cow2021-03-10v4No1 / 632
748amnon high in holstein dairy cow compared to jersey cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 638
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
236amnon high in root compared to sediment marine sediment in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 674
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
347amnoncommon permafrost, soil, kingdom of norway, svalbard archipelago, depth (soil) 20-30cm2018-07-15v4No1 / 698
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york depth 0-5cm ph 6 coarse-loamy soil stover ammendment soil )2020-03-27v4No1 / 747
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph<5, china2018-11-26v4No1 / 823
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-08-02v4No1 / 901
206amnoncommon in dust storm air from israel particles <10um size (common air, dust, israel, size < 10um, dust storm)2017-10-04v4No1 / 902
126amnoncommon rhizosphere, hordeum vulgare, germany, winter barley2017-04-14v4No1 / 925
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-07-28v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm, restored prairie)2021-07-28v4No1 / 968
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 25-50cm)2021-08-03v4No1 / 974
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
687amnon high in bos taurus chinese bohai black beef cattle chinese luxi yellow beef cattle compared to capra hircus goat chinese laoshan milk goat in research facility rumen rumen liquid shandong province china 2028-03-09v4No1 / 1022
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in permafrost soil kingdom of norway svalbard archipelago 2018-07-15v4No1 / 1080
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
448amnon high in control compared to equine grass sickness disease in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 1084
236amnoncommon ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 1156
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
423amnon high in no human contact chernobyl exclusion zone compared to human contact in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 1229
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-07-28v4No1 / 1241
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in soil canada bon portage island bird oceanodroma leucorhoa seabird burrow )2017-11-07v4No1 / 1247
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-08-02v4No1 / 1387
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
784amnon high in spartina alterniflora sporobolus alterniflorus smooth cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut depth 0-5cm long island sound 2021-05-16v4No1 / 1421
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, depth 0-20cm, china, leizhou nature reserve2019-12-16v4No1 / 1437
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
309amnoncommon rhizosphere, germany, red fescue grass, festuca rubra2018-04-05v4No1 / 1510
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth 10-25cm)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 1714
18amnon high in equus caballus compared to equus przewalskii in feces 2016-11-14v4No1 / 1800
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
236amnoncommon ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 1904
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
265amnon high in soil compared to water soilwater in canada province of quebec 2017-12-11v4No1 / 2715
748amnon high in rumen ruminal fluid compared to feces in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2716
676amnon high in fish farm aquarium compared to water inlet in saline water sea water french republic english channel coastal waters of france 2028-02-27v4No1 / 3729
676amnon high in saline water sea water compared to biofilm saline water biofilm in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 4350
100amnon high in ph ph<6 compared to ph>6 in park soil urban biome new york city central park 2017-04-03v4No1 / 5770

Problems / suggestions? Please email info AT dbbact DOT org