Search result for sequence:
GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
united states of america0.284242
plant0.187025
skin0.160102
state of california0.147413
leaf0.139286
research facility0.132512
feces0.125918
homo sapiens0.119668
farm0.118386
soil0.111959
greenhouse0.104615
austria0.104348
air0.096270
china0.095861
oryza sativa0.089077
pig0.084084
sus scrofa0.084084
food product0.074766
state of michigan0.072072
ethiopia0.071974
mus musculus0.071468
state of rhode island0.070288
canada0.069164
fermented food product0.068678
sweden0.065147
mouse0.061388
adult0.059701
equus caballus0.059406
tonsil0.059113
bodega bay0.058252
saliva0.056980
stem0.056604
ocean0.053908
mouth0.053571
duodenum0.053039
digestive system0.053004
rhizosphere0.053004
horse0.052805
paddy field soil0.052805
state of north carolina0.052117
zostera marina0.050794
marine eelgrass0.050794
felis catus0.050794
cultivated habitat0.049536
root0.049130
dust0.046434
rice0.045902
pair of nares0.045640
fish0.044211
texas0.043887
female0.041691
urban biome0.040134
venezuela0.040000
amerindian0.040000
hunter gatherer0.039604
ethiopian banana0.039604
ensete ventricosum0.039604
LOWER IN feces0.039216
stomach0.038835
infant0.038388
cat0.038095
israel0.037736
LOWER IN control0.035794
caecum0.033898
building0.033501
arm0.033501
LOWER IN caecum0.033333
herbivorous beetle0.033223
nida basin0.033223
bird0.033223
nile tilapia0.033223
state of minnesota0.032949
beetle0.032680
poland0.032680
oreochromis niloticus0.032680
mucus0.032680
united kingdom0.032680
whole body0.032154
monkey0.032154
kingdom of spain0.031646
sediment0.030364
child0.029985
colon0.029762
oncorhynchus mykiss0.026997
rainbow trout0.026997
allium cepa0.026936
fish feed0.026936
england0.026756
size < 10um0.026756
bolivia0.026756
hunan province0.026756
triticum aestivum0.026756
tree0.026578
rock0.026578
ileum0.026519
depth 0-5cm0.026403
pasture0.026403
province of quebec0.026403
heilongjiang province0.026403
germany0.026172
Fraction of dbbact annotations with this term covered by the query
TermScore
duodenum0.750000
ethiopia0.750000
urban biome0.750000
equus caballus0.750000
oncorhynchus mykiss0.750000
rainbow trout0.750000
air0.727273
allium cepa0.666667
dust0.666667
fish feed0.666667
state of illinois0.666667
building0.666667
tonsil0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
snake0.666667
axilla0.666667
horse0.666667
jejunum0.666667
day 00.666667
paddy field soil0.666667
plant0.625000
sweden0.625000
oryza sativa0.600000
skin0.583333
LOWER IN caecum0.555556
garlic0.500000
plant cell0.500000
greenhouse0.500000
aloe arborescens0.500000
aloe0.500000
dracaena draco0.500000
dracaena fragrans0.500000
howea forsteriana0.500000
musa acuminate0.500000
age 30 days0.500000
dairy0.500000
crioceris quatuordecimpunctata0.500000
herbivorous beetle0.500000
nida basin0.500000
bodega bay0.500000
ginger0.500000
state of rhode island0.500000
onion0.500000
allium sativum0.500000
cleanroom0.500000
alpine bog0.500000
plant surface0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
galapagos islands0.500000
bird0.500000
finch0.500000
geospiza difficilis0.500000
sharp-beaked ground finch0.500000
camarhynchus parvulus0.500000
small tree finch0.500000
nile tilapia0.500000
cyprinus carpio0.500000
common carp0.500000
england0.500000
chicago0.500000
bedroom0.500000
train0.500000
boston0.500000
size < 10um0.500000
clear day0.500000
age 6-10 weeks0.500000
pyrenees0.500000
ant0.500000
pseudomyrmex pallidus0.500000
liolaemus ruibali0.500000
hunter gatherer0.500000
dust storm0.500000
grassland0.500000
steppe0.500000
crioceris duodecimpunctata0.500000
calophya0.500000
ruellia terminalis0.500000
arboreal snake0.500000
black rat snake0.500000
pantherophis obsoletus0.500000
southern united states0.500000
scallion0.500000
interdigital region0.500000
qinghai province0.500000
anser0.500000
goose0.500000
greylag goose0.500000
state of north carolina0.500000
tsuga dumosa0.500000
himalayan hemlock0.500000
lapland0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
kitchen0.500000
sink0.500000
kimchi0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.381443
feces0.123711
homo sapiens0.113402
plant0.109966
research facility0.106529
skin0.092784
leaf0.089347
state of california0.089347
china0.075601
farm0.075601
soil0.075601
austria0.061856
greenhouse0.058419
air0.051546
pig0.048110
sus scrofa0.048110
oryza sativa0.048110
mus musculus0.044674
food product0.041237
state of michigan0.041237
adult0.041237
canada0.041237
state of rhode island0.037801
ethiopia0.037801
fermented food product0.037801
mouse0.037801
ocean0.034364
sweden0.034364
saliva0.034364
bodega bay0.030928
digestive system0.030928
tonsil0.030928
stem0.030928
equus caballus0.030928
mouth0.030928
rhizosphere0.030928
duodenum0.027491
zostera marina0.027491
marine eelgrass0.027491
root0.027491
felis catus0.027491
state of north carolina0.027491
horse0.027491
LOWER IN control0.027491
paddy field soil0.027491
cultivated habitat0.027491
dust0.024055
texas0.024055
fish0.024055
female0.024055
pair of nares0.024055
rice0.024055
caecum0.020619
urban biome0.020619
israel0.020619
stomach0.020619
venezuela0.020619
amerindian0.020619
hunter gatherer0.020619
cat0.020619
infant0.020619
ethiopian banana0.020619
ensete ventricosum0.020619
LOWER IN feces0.020619
herbivorous beetle0.017182
nida basin0.017182
beetle0.017182
whole body0.017182
poland0.017182
sediment0.017182
monkey0.017182
bird0.017182
oreochromis niloticus0.017182
nile tilapia0.017182
state of minnesota0.017182
building0.017182
kingdom of spain0.017182
arm0.017182
LOWER IN caecum0.017182
mucus0.017182
colon0.017182
control0.017182
child0.017182
united kingdom0.017182
obsolete_juvenile stage0.013746
allium cepa0.013746
fish feed0.013746
england0.013746
intestine0.013746
city0.013746
size < 10um0.013746
snow0.013746
depth 0-5cm0.013746
kingdom of norway0.013746
oral cavity0.013746
pasture0.013746
wild0.013746
oncorhynchus mykiss0.013746
rainbow trout0.013746
province of quebec0.013746
Exp. ID User ID Description Date Region Flag Sequences
311amnongarlic chloroplast (other chloroplast, garlic)2018-04-09v4No1 / 1
321amnonplant chloroplast (other plant cell, plant, chloroplast)2018-04-21v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 1
361amnonhighfreq leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 1
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
515amnonhighfreq crioceris quatuordecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 3
74amnonhighfreq food product, allium cepa, united states of america2017-02-27v4No1 / 4
236amnonhighfreq state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 4
311amnonhighfreq ginger, food product, united states of america, state of rhode island2018-04-09v4No1 / 4
311amnonhighfreq united states of america, state of rhode island, allium cepa, onion, food product2018-04-09v4No1 / 4
74amnonhighfreq food product, allium sativum, united states of america2017-02-27v4No1 / 5
236amnonhighfreq state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 5
308amnonhigh freq. in spacecraft assembly cleanroom floor (highfreq united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 5
311amnonhighfreq united states of america, state of rhode island, garlic, food product2018-04-09v4No1 / 6
130amnonhighfreq peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 7
236amnonhighfreq state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 8
274amnonhighfreq monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
91amnonhighfreq china, fermented food product, serofluid dish, jiangshui2017-03-08v4No1 / 9
108amnonhighfreq research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
74amnoncommon food product, allium sativum, united states of america2017-02-27v4No1 / 10
255amnoncommon in fish feed (highfreq united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 10
396amnonhighfreq fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 10
523amnonhighfreq state of illinois, chicago, united states of america, bedroom, building, air2019-07-03v4No1 / 10
195amnonhigh freq. in boston subway surfaces (highfreq city, urban biome, train, boston)2017-09-07v4No1 / 11
206amnonhigh freq. in air from israel particles <10um size (highfreq air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 11
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 11
403amnonhighfreq air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 11
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex pallidus2018-11-22v4No1 / 11
71amnonhighfreq liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
75amnonhighfreq homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
206amnonhigh freq. in dust storm air from israel particles <10um size (highfreq israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 12
279amnonhighfreq china, grassland, leaf, stem, steppe, mongolia2018-01-24v4No1 / 12
515amnonhighfreq crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 12
63amnonhigh freq. in skin in american gut (highfreq skin, homo sapiens)2017-02-15v4No1 / 13
74amnoncommon food product, allium cepa, united states of america2017-02-27v4No1 / 13
97amnoncommon calophya, adult, florida, brazil2017-04-01v4No1 / 13
389amnonhighfreq pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 13
536amnonhighfreq arboreal snake, black rat snake, pantherophis obsoletus, southern united states, united states of america, skin, snake2019-07-28v4No1 / 13
158amnonhighfreq cat, felis catus, united states of america, conjunctiva2017-07-06v4No1 / 14
311amnonhighfreq united states of america, state of rhode island, food product, scallion2018-04-09v4No1 / 14
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-10v4No1 / 14
371amnonhighfreq homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
158amnonhighfreq united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 15
336amnonhighfreq china, feces, qinghai province, anser, goose, greylag goose2018-05-16v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
432amnonhighfreq united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
511amnonhighfreq snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 15
515amnoncommon crioceris quatuordecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 15
158amnonhighfreq cat, felis catus, united states of america, axilla2017-07-06v4No1 / 17
180amnonhighfreq dermanyssus gallinae, red poulty mite, czech republic, poulty farm, egg, larval stage2017-08-14v4No1 / 17
199amnonhigh freq. in kitchen sink (highfreq building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 17
311amnoncommon united states of america, state of rhode island, fermented food product, kimchi2018-04-09v4No1 / 17
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
418amnonhighfreq coral, ocean, acropora hyacinthus, tissue2018-12-02v4No1 / 17
432amnonhighfreq united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
287amnonhighfreq japan, snow field, mountain, depth 6-7m2018-01-29v4No1 / 18
361amnoncommon leaf, austria, greenhouse, plant, nephrolepis cordifolia2018-08-21v4No1 / 18
384amnonhighfreq equus caballus, horse, canada, farm, mouth, oral cavity, saliva, pasture2018-10-22v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (highfreq ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
511amnonhighfreq snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 19
539amnonhighfreq days 1-15, aerobic fermentation, early timepoint, fermented food product, ethiopian banana, ensete ventricosum, ethiopia2019-07-31v4No1 / 20
396amnoncommon fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 21
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 21
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 22
265amnonhigh freq. in tree leaves (highfreq canada, province of quebec, tree, leaf)2017-12-11v4No1 / 22
311amnoncommon united states of america, state of rhode island, miso, fermented food product2018-04-09v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
198amnonhighfreq sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature habitat2017-09-13v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, state of california, floor, dust, cleanroom)2018-03-31v4No1 / 23
432amnonhighfreq united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
432amnonhighfreq united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 23
539amnonhighfreq anaerobic fermentation, days 30-60, late timepoint, fermented food product, ethiopian banana, ensete ventricosum, ethiopia2019-07-31v4No1 / 23
13amnon high in mouth esophagus stomach duodenum ileum compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to mouth saliva in felis catus cat united states of america )2017-07-06v4No1 / 26
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 26
311amnoncommon united states of america, state of rhode island, allium cepa, onion, food product2018-04-09v4No1 / 26
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 30
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, cold temperature habitat, 12c)2018-04-10v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
403amnoncommon air, kingdom of spain, pyrenees, spring2018-11-18v4No1 / 32
311amnoncommon united states of america, state of rhode island, garlic, food product2018-04-09v4No1 / 34
361amnoncommon leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 34
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 35
108amnoncommon research facility, texas, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
287amnoncommon japan, snow field, mountain, depth 1-2m2018-01-29v4No1 / 35
539amnoncommon days 1-15, aerobic fermentation, early timepoint, fermented food product, ethiopian banana, ensete ventricosum, ethiopia2019-07-31v4No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
367amnoncommon air, namibia, coast2018-09-02v4No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 37
361amnoncommon leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 37
403amnoncommon air, kingdom of spain, pyrenees, summer2018-11-18v4No1 / 39
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
59amnoncommon trigona hyalinata, digestive system2017-02-02v4No1 / 43
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
287amnoncommon japan, snow field, mountain, depth 6-7m2018-01-29v4No1 / 47
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
79amnoncommon skin, united states of america, harbor seal, phoca vitulina2017-03-03v4No1 / 49
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
515amnoncommon herbivorous beetle, nida basin, plant, aphthona venustula, beetle, whole body, poland2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in cold temperature habitat temp 12c compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, state of california, hospital, floor, dust)2018-03-31v4No1 / 57
523amnoncommon state of illinois, chicago, united states of america, bedroom, building, air2019-07-03v4No1 / 58
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island fermented food product kimchi )2018-04-09v4No1 / 62
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
91amnoncommon china, fermented food product, serofluid dish, jiangshui2017-03-08v4No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
299amnon high in control compared to cancer mouth neoplasm in saliva adult homo sapiens china 2018-02-27v4No1 / 75
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 77
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
163amnoncommon china, ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach2017-07-13v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 81
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
336amnoncommon china, feces, qinghai province, anser, goose, greylag goose2018-05-16v4No1 / 87
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, wall, urban biome, united states of america)2017-10-01v4No1 / 90
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
26amnoncommon canis lupus familiaris, united states of america, mouth, saliva2016-12-05v4No1 / 99
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
198amnoncommon yellowstone national park, united states of america, geothermal field, high temperature habitat, water, hot spring2017-09-13v4No1 / 103
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
539amnon high in aerobic fermentation days 1-15 early timepoint compared to anaerobic fermentation days 30-60 late timepoint in fermented food product ethiopian banana ensete ventricosum ethiopia 2019-07-31v4No1 / 110
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
198amnoncommon sediment, yellowstone national park, united states of america, thermophilic sediment, geothermal field, high temperature habitat2017-09-13v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, train, boston)2017-09-07v4No1 / 116
361amnoncommon leaf, austria, greenhouse, plant, aechmea eurycorymbus2018-08-21v4No1 / 117
311amnoncommon united states of america, state of rhode island, food product, scallion2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
517amnoncommon forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in anaerobic fermentation days 30-60 late timepoint fermented food product ethiopian banana ensete ventricosum ethiopia 2019-07-31v4No1 / 123
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, barn, hay2018-10-22v4No1 / 131
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
511amnoncommon snow, depth 0-5cm, united states of america, state of colorado2019-03-20v4No1 / 134
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
291amnoncommon canis lupus familiaris, dog, pair of nares, nasal cavity, germany2018-02-01v4No1 / 144
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
108amnon high in colon compared to caecum in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 157
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, egg, larval stage2017-08-14v4No1 / 158
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
539amnoncommon anaerobic fermentation, days 30-60, late timepoint, fermented food product, ethiopian banana, ensete ventricosum, ethiopia2019-07-31v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
26amnoncommon united states of america, felis catus, mouth, saliva2016-12-05v4No1 / 163
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
384amnoncommon equus caballus, horse, canada, farm, nasal cavity, pair of nares, pasture2018-10-22v4No1 / 175
530amnoncommon hunan province, adula, china, farm, snake farm, feces, pit viper, deinagkistrodon acutus, snake2019-07-21v4No1 / 178
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, china, control)2018-02-27v4No1 / 179
311amnoncommon ginger, food product, united states of america, state of rhode island2018-04-09v4No1 / 180
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
536amnoncommon arboreal snake, black rat snake, pantherophis obsoletus, southern united states, united states of america, skin, snake2019-07-28v4No1 / 184
402amnon high in zone 1 compared to zone 2,3 in china sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region 2018-11-18v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
384amnoncommon equus caballus, horse, canada, farm, mouth, oral cavity, saliva, pasture2018-10-22v4No1 / 201
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 213
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
104amnoncommon homo sapiens, russia, moscow, mouth, subgingival plaque, dentition2017-04-05v4No1 / 227
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
384amnon high in pasture compared to barn hay in equus caballus horse canada farm mouth saliva 2018-10-22v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
205amnoncommon in Ely Greenstone rock piles (common rock, united states of america, quarry, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth 15cm depth in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 265
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-22v4No1 / 267
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 270
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
384amnoncommon equus caballus, horse, canada, farm, barn, hay, mouth, oral cavity, saliva2018-10-22v4No1 / 274
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
236amnon high in leaf compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 287
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
77amnon high in winter compared to summer in kelp forest marine biome algae australia 2017-02-28v4No1 / 303
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 365
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 489
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cn compared to depth depth 15cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 505
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
384amnon high in mouth oral cavity saliva compared to pair of nares nasal cavity in equus caballus horse canada farm 2018-10-22v4No1 / 604
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america florida 2019-01-14v4No1 / 648
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, heilongjiang province, ph 6-72018-12-04v4No1 / 682
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 20-30cm2018-07-15v4No1 / 698
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, heilongjiang province, ph 5-62018-12-04v4No1 / 726
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, china, zhejiang province, paddy field soil, copper)2018-12-02v4No1 / 740
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, yunnan province2018-12-02v4No1 / 821
412amnoncommon soil, china, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<52018-11-26v4No1 / 823
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in forearm arm skin compared to feces in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, china, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>52018-11-26v4No1 / 856
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee cultivated habitat populus tree 2019-01-13v4No1 / 890
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
422amnoncommon soil, paddy field soil, cultivated habitat, china, jiangsu province, oryza sativa2018-12-02v4No1 / 957
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, heilongjiang province2018-12-02v4No1 / 1049
347amnon high in depth 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
448amnon high in control compared to equine grass sickness disease in equus caballus horse feces united kingdom farm 2019-01-08v4No1 / 1084
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-07v4No1 / 1156
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, heilongjiang province, ph 7-82018-12-04v4No1 / 1169
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
422amnoncommon soil, paddy field soil, cultivated habitat, china, oryza sativa, hunan province, hubei province2018-12-02v4No1 / 1399
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat china soil )2017-07-02v4No1 / 1714
18amnon high in equus caballus compared to equus przewalskii in feces 2016-11-14v4No1 / 1800
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult united kingdom skin cambridgeshire triturus cristatus )2018-07-30v4No1 / 1834
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, china, soil, root)2017-07-02v4No1 / 1977
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult united kingdom skin cambridgeshire lissotriton vulgaris )2018-07-30v4No1 / 2162
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770

Problems / suggestions? Please email info AT dbbact DOT org