Search result for sequence:
GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCTGCCGTCAAATCCCAGGGCTTAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
soil0.282704
bulk soil0.203390
ph 50.160000
mexico0.153005
fertilized soil0.146341
myrtillocactus geometrizans0.142857
opuntia robusta0.142857
cactus0.133333
semi-arid0.133333
ph 60.133333
rhizosphere0.129870
triticum aestivum0.127660
arachis hypogaea0.117647
peanut0.117647
coarse-loamy soil0.117647
day 820.117647
mature barley plants0.117647
days 1800.117647
quzhou county0.117647
thyrow0.117647
albic luvisol0.117647
lettuce0.117647
biochar0.113208
depth (soil) 0-5cm0.111111
hordeum vulgare0.111111
germany0.110092
ph 7-80.109091
state of new york0.108108
desert0.105263
depth (soil) 15cm0.105263
pot expreiment0.105263
china0.102326
depth (soil) 0-10cm0.093023
ph 6-6.50.090909
minas gerais state0.090909
campos rupestres0.090909
elevation 2000-3000m0.090909
ph 6.40.090909
state of idaho0.086957
mountain0.086957
zea mays0.080000
leaf0.074074
zhejiang province0.074074
ph 4-50.071429
switzerland0.068966
state of wyoming0.064516
jinxiang county0.064516
root zone soil0.062500
depth 1cm0.062500
soil crust0.062500
guanajuato0.062500
red soil0.062500
barbacenia macrantha0.062500
triticum aestivum l. cv., xiaoyan no. 220.062500
silty clay0.062500
without plants0.062500
difenoconazole0.062500
fungicide0.062500
tobacco field0.062500
limestone0.062500
siliceous parent material0.062500
canton of graubunden0.062500
lower saxony0.062500
sandy soil0.062500
mineral fertilization0.062500
crop rotation0.062500
bernburg0.062500
leaf surface0.061538
manured soil0.060606
cambisol0.060606
depth 0-20cm0.060606
garlic0.060606
allium sativum0.060606
sugarcane0.060606
saccharum0.060606
npk fertilization0.060606
state of utah0.058824
ph<50.058824
maize field0.058824
guangzhou city prefecture0.057143
ph 7.60.055556
united states of america0.054554
hunan province0.054054
root0.053333
brazil0.051282
topsoil0.051282
skin0.042553
LOWER IN rhizosphere0.037383
LOWER IN glacier peak wilderness0.032787
medicine bow - routt national forest0.032787
arapaho national forest0.032787
depth (snow) 0-5cm0.032787
LOWER IN high npk fertilizer dose0.032787
low npk fertilizer dose0.032787
riwoqe county0.032787
merlot0.032258
grapevine0.032258
LOWER IN non-manured0.032258
ph 5.50.032258
boechera stricta0.032258
Fraction of dbbact annotations with this term covered by the query
TermScore
state of wyoming1.000000
LOWER IN glacier peak wilderness1.000000
medicine bow - routt national forest1.000000
arapaho national forest1.000000
depth (snow) 0-5cm1.000000
jinxiang county1.000000
LOWER IN high npk fertilizer dose1.000000
low npk fertilizer dose1.000000
riwoqe county1.000000
fertilized soil0.600000
merlot0.500000
grapevine0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN non-manured0.500000
ph 5.50.500000
boechera stricta0.500000
depth 1cm0.500000
soil crust0.500000
beach0.500000
aerosol0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
agave0.500000
agave salmiana0.500000
guanajuato0.500000
red soil0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
crop0.500000
anterior naris0.500000
LOWER IN chronic rhinosinusitis0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
LOWER IN stover amended0.500000
triticum aestivum l. cv., xiaoyan no. 220.500000
silty clay0.500000
urea enriched soil0.500000
mature barley plants0.500000
days 1800.500000
quzhou county0.500000
without plants0.500000
difenoconazole0.500000
fungicide0.500000
tobacco field0.500000
limestone0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
grazing exclusion0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
maize pre-crop0.500000
depth 0-12cm0.500000
hapludalf0.500000
alfisol0.500000
illinois0.500000
dekalb county0.500000
bulk soil0.428571
ph 50.400000
leaf surface0.400000
biochar0.375000
vitis vinifera0.333333
cactus0.333333
semi-arid0.333333
foot0.333333
manured soil0.333333
LOWER IN non-fertilized soil0.333333
state of idaho0.333333
ph 60.333333
dry0.333333
monterey bay0.333333
newt0.333333
cambisol0.333333
heilongjiang province0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.683333
china0.366667
united states of america0.233333
rhizosphere0.166667
bulk soil0.133333
germany0.133333
mexico0.116667
ph 50.100000
state of new york0.083333
myrtillocactus geometrizans0.083333
opuntia robusta0.083333
cactus0.083333
semi-arid0.083333
fertilized soil0.083333
ph 60.083333
triticum aestivum0.083333
ph 7-80.083333
arachis hypogaea0.066667
peanut0.066667
desert0.066667
depth (soil) 0-5cm0.066667
biochar0.066667
coarse-loamy soil0.066667
day 820.066667
mature barley plants0.066667
days 1800.066667
hordeum vulgare0.066667
ph 4-50.066667
depth (soil) 15cm0.066667
quzhou county0.066667
zhejiang province0.066667
depth (soil) 0-10cm0.066667
thyrow0.066667
albic luvisol0.066667
lettuce0.066667
pot expreiment0.066667
leaf0.050000
ph 6-6.50.050000
state of idaho0.050000
zea mays0.050000
minas gerais state0.050000
campos rupestres0.050000
brazil0.050000
mountain0.050000
switzerland0.050000
elevation 2000-3000m0.050000
ph 6.40.050000
root zone soil0.033333
homo sapiens0.033333
skin0.033333
control0.033333
manured soil0.033333
root0.033333
state of utah0.033333
depth 1cm0.033333
soil crust0.033333
adult0.033333
leaf surface0.033333
guanajuato0.033333
hunan province0.033333
red soil0.033333
cambisol0.033333
ph<50.033333
barbacenia macrantha0.033333
state of wyoming0.033333
triticum aestivum l. cv., xiaoyan no. 220.033333
silty clay0.033333
without plants0.033333
difenoconazole0.033333
fungicide0.033333
tobacco field0.033333
limestone0.033333
depth 0-20cm0.033333
jinxiang county0.033333
garlic0.033333
allium sativum0.033333
farm0.033333
siliceous parent material0.033333
canton of graubunden0.033333
depth (soil) 0-20cm0.033333
sugarcane0.033333
saccharum0.033333
topsoil0.033333
guangzhou city prefecture0.033333
lower saxony0.033333
sandy soil0.033333
maize field0.033333
LOWER IN rhizosphere0.033333
mineral fertilization0.033333
npk fertilization0.033333
crop rotation0.033333
ph 7.60.033333
bernburg0.033333
vitis vinifera0.016667
merlot0.016667
grapevine0.016667
LOWER IN root0.016667
summer0.016667
LOWER IN winter0.016667
heavy metal0.016667
Exp. ID User ID Description Date Region Flag Sequences
259amnonhigh freq. in soil and rhizpsphere of peanut plants (dominant soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 8
129amnondominant ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 9
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, crop2019-09-20v4No1 / 11
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol from Germany (dominant mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 15
1008amnon high in low npk fertilizer dose compared to high npk fertilizer dose in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 rhizosphere 2023-01-26v4No1 / 135
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
298amnonlower in wetted soil 18hrs compared to dried soil ( high in dry compared to irrigated in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 205
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
915amnon high in medicine bow - routt national forest arapaho national forest state of wyoming state of colorado compared to glacier peak wilderness state of washington in depth (snow) 0-5cm snow united states of america 2022-07-02v4No1 / 263
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
931amnon high in jejunum duodenum compared to ileum feces colon caecum in tibet autonomous region riwoqe county china yak bos grunniens 2022-08-25v3No1 / 970
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org