Search result for sequence:
GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTTCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
ant0.201183
costa rica0.188586
united states of america0.179527
sus scrofa0.171858
pig0.171858
research facility0.156863
larval stage0.146341
feces0.122898
farm0.109589
depth 0-20cm0.109453
tonsil0.103226
glycine max0.098160
digestive system0.097561
bos taurus0.094675
mus musculus0.094118
state of michigan0.093567
stomach0.090056
state of texas0.087774
mouse0.087500
wild0.087432
oncorhynchus mykiss0.081633
rainbow trout0.081633
rumen0.077064
fish0.076087
ileum0.072727
pseudomyrmex flavicornis0.068966
liolaemus ruibali0.068966
pseudomyrmex nigrocinctus0.068966
kenya0.068966
lushan mountain0.068966
soybean0.066667
forested area0.066667
argentina0.064516
jiangxi province0.064516
LOWER IN feces0.064103
female organism0.060606
fish feed0.056738
alouatta palliata0.056738
mantled howler monkey0.056738
sweden0.056338
nile tilapia0.055944
cold environment0.055944
pseudomyrmex spinicola0.055944
topsoil0.055556
LOWER IN fasting0.055172
india0.054920
adult organism0.054920
oreochromis niloticus0.054422
small intestine0.054422
duodenum0.053452
LOWER IN caecum0.052632
early timepoints0.052288
LOWER IN late timepoints0.052288
caecum0.050000
homo sapiens0.048458
female0.047337
skin0.044693
root nodule0.043011
holstein dairy cow0.043011
soy bean0.042553
england0.042553
12c0.042553
province of alberta0.042553
dermanyssus gallinae0.042553
red poulty mite0.042553
poulty farm0.042553
holstein-friesian bull0.042553
republic of congo0.042553
nouabale-ndoki national park0.042553
tropical grassland biome0.042553
nanger granti0.042553
gazelle0.042553
state of mississippi0.042553
jejunum0.042105
fish farm0.042105
crematogaster0.041667
ph 4.50.041667
ireland0.040816
china0.040498
monkey0.040000
age 4 weeks0.040000
age 6 weeks0.040000
zoological garden0.040000
ruminal fluid0.039216
state of minnesota0.038462
czech republic0.038462
pair of nares0.038462
LOWER IN soil0.038095
male organism0.037736
cow0.035714
united kingdom0.035088
child0.031746
canada0.030303
intestine0.028986
soil0.028986
state of missouri0.028777
centris atripes0.028777
chlorocebus aethiops0.028777
vervet monkey0.028777
age 6-10 weeks0.028777
Fraction of dbbact annotations with this term covered by the query
TermScore
root nodule0.666667
fish feed0.666667
alouatta palliata0.666667
mantled howler monkey0.666667
holstein dairy cow0.666667
soy bean0.500000
state of missouri0.500000
ant0.500000
pseudomyrmex flavicornis0.500000
catfish0.500000
nile tilapia0.500000
liolaemus ruibali0.500000
centris atripes0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
age 6-10 weeks0.500000
pseudomyrmex nigrocinctus0.500000
oncorhynchus mykiss0.500000
england0.500000
rainbow trout0.500000
pseudomyrmex nigropilosus0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
pseudomyrmex spinicola0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
province of alberta0.500000
guanacaste conservation area0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
root structure0.500000
state of rhode island0.500000
miso food product0.500000
ailurus fulgens0.500000
red panda0.500000
ixodes scapularis0.500000
gut content0.500000
LOWER IN ascending colon0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
cyprinus carpio0.500000
common carp0.500000
przewalski horse0.500000
acacia ants0.500000
LOWER IN pseudomyrmex gracilis0.500000
LOWER IN generalist0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
douchi0.500000
rumen solids0.500000
LOWER IN rumen liquid0.500000
holstein-friesian bull0.500000
age 1-3 weeks0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
age 12-19 weeks0.500000
skh-1 hairless mouse0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
LOWER IN age 1-3 weeks0.500000
age 130.500000
age 8 months0.500000
rhesus macaque0.500000
LOWER IN juvenile organism0.500000
dicentrarchus labrax0.500000
ria formosa0.500000
open water pond0.500000
seabass0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
tropical grassland biome0.500000
kenya0.500000
nanger granti0.500000
gazelle0.500000
a/j0.500000
hirundo rustica0.500000
barn swallow0.500000
antananarivo0.500000
LOWER IN central african republic0.500000
LOWER IN bangui0.500000
masai mara national park0.500000
madoqua kirkii0.500000
kirk's dik-dik0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN cefoperazone0.500000
age 10-15 years0.500000
LOWER IN age < 1 year0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
central america0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.459259
feces0.274074
research facility0.266667
costa rica0.140741
ant0.125926
sus scrofa0.118519
pig0.118519
larval stage0.111111
china0.096296
farm0.088889
depth 0-20cm0.081481
homo sapiens0.081481
digestive system0.074074
mus musculus0.074074
mouse0.066667
glycine max0.059259
stomach0.059259
tonsil0.059259
state of michigan0.059259
wild0.059259
bos taurus0.059259
state of texas0.051852
fish0.051852
rumen0.051852
caecum0.044444
oncorhynchus mykiss0.044444
rainbow trout0.044444
sweden0.044444
ileum0.044444
soil0.044444
pseudomyrmex flavicornis0.037037
soybean0.037037
argentina0.037037
liolaemus ruibali0.037037
pseudomyrmex nigrocinctus0.037037
female0.037037
control0.037037
LOWER IN feces0.037037
kenya0.037037
female organism0.037037
topsoil0.037037
jiangxi province0.037037
forested area0.037037
lushan mountain0.037037
oreochromis niloticus0.029630
nile tilapia0.029630
small intestine0.029630
fish feed0.029630
cold environment0.029630
pseudomyrmex spinicola0.029630
LOWER IN caecum0.029630
alouatta palliata0.029630
mantled howler monkey0.029630
early timepoints0.029630
LOWER IN fasting0.029630
LOWER IN late timepoints0.029630
adult0.029630
duodenum0.029630
skin0.029630
india0.029630
adult organism0.029630
soy bean0.022222
root nodule0.022222
state of minnesota0.022222
crematogaster0.022222
rhizosphere0.022222
monkey0.022222
age 4 weeks0.022222
intestine0.022222
england0.022222
12c0.022222
male0.022222
canada0.022222
age 6 weeks0.022222
male organism0.022222
province of alberta0.022222
czech republic0.022222
dermanyssus gallinae0.022222
red poulty mite0.022222
poulty farm0.022222
zoological garden0.022222
jejunum0.022222
LOWER IN control0.022222
ireland0.022222
holstein-friesian bull0.022222
pair of nares0.022222
united kingdom0.022222
LOWER IN soil0.022222
fish farm0.022222
republic of congo0.022222
nouabale-ndoki national park0.022222
tropical grassland biome0.022222
nanger granti0.022222
gazelle0.022222
child0.022222
ph 4.50.022222
holstein dairy cow0.022222
cow0.022222
ruminal fluid0.022222
state of mississippi0.022222
Exp. ID User ID Description Date Region Flag Sequences
747amnonsoy bean chloroplast (other glycine max, chloroplast, soy bean)2021-03-10v4No1 / 1
747amnondominant in soy bean root nodules (dominant united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 4
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
747amnoncommon in soy bean root nodules (common united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 7
255amnoncommon digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 8
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
271amnondominant rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 9
71amnondominant research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 10
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
59amnondominant digestive system, centris atripes2017-02-03v4No1 / 11
274amnondominant feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 11
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
71amnondominant research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 12
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
396amnondominant digestive system, intestine, oncorhynchus mykiss, england, fish, rainbow trout2018-11-14v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 12
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
625amnondominant feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 16
180amnondominant larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
59amnoncommon digestive system, centris atripes2017-02-03v4No1 / 20
271amnoncommon root structure, glycine max, soybean, depth 0-20cm, root, root nodule, china2018-01-09v4No1 / 20
311amnoncommon united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 22
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 29
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
71amnoncommon research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 33
180amnoncommon adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 36
497amnoncommon feces, farm, gallus gallus, austria, chicken, broiler chicken, age 2 weeks2019-03-04v4No1 / 39
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
396amnoncommon digestive system, intestine, cyprinus carpio, england, fish, common carp2018-11-14v4No1 / 45
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 47
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
408amnon high in pseudomyrmex nigrocinctus pseudomyrmex flavicornis pseudomyrmex spinicola acacia ants compared to pseudomyrmex gracilis generalist in united states of america costa rica pseudomyrmex ant 2018-11-22v4No1 / 53
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 59
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 67
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean depth 0-20cm china 2018-01-09v4No1 / 110
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 120
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
180amnoncommon larval stage, czech republic, dermanyssus gallinae, red poulty mite, poulty farm, shelled egg2017-08-14v4No1 / 158
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in feces south africa syncerus caffer caffer cape buffalo )2017-03-08v4No1 / 194
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
78amnoncommon feces, tropical grassland biome, kenya, nanger granti, gazelle2017-03-01v4No1 / 234
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
781amnoncommon feces, kenya, wild, masai mara national park, madoqua kirkii, kirk's dik-dik2021-04-28v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
78amnonhigher in younger gazelles ( high in age young age compared to old age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 268
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
80amnoncommon feces, state of florida, central america, alouatta palliata, mantled howler monkey2017-03-03v4No1 / 309
625amnoncommon feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 309
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
559amnoncommon feces, united states of america, zoological garden, diceros bicornis, black rhinoceros, captive2019-11-03v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
781amnoncommon feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 400
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 500-600m2020-09-25v4No1 / 575
788amnon high in feces cherokia georgiana georgiana millipede compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 589
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, holstein dairy cow2028-03-09v4No1 / 593
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, elevation 200-300m, lushan mountain2020-09-25v4No1 / 613
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 614
667amnoncommon soil, topsoil, jiangxi province, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.52020-09-25v4No1 / 630
748amnon high in holstein dairy cow compared to jersey cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 638
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 643
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, depth 0-20cm, forested area, china, lushan mountain, elevation 800-900m2020-09-25v4No1 / 694
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
667amnoncommon soil, topsoil, jiangxi province, ph 4, depth 0-20cm, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m2020-09-25v4No1 / 777
78amnon high in female compared to male in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 811
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
271amnoncommon rhizosphere, glycine max, soybean, depth 0-20cm, china2018-01-09v4No1 / 1459
748amnon high in rumen ruminal fluid compared to feces in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2716
271amnoncommon soil, depth 0-20cm, china2018-01-09v4No1 / 2856
676amnon high in fish farm aquarium compared to water inlet in saline water sea water french republic english channel coastal waters of france 2028-02-27v4No1 / 3729
676amnon high in saline water sea water compared to biofilm saline water biofilm in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 4350

Problems / suggestions? Please email info AT dbbact DOT org