Search result for sequence:
GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTTCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
ant0.237762
costa rica0.216524
larval stage0.172414
united states of america0.172118
pig0.154930
sus scrofa0.154930
research facility0.142750
tonsil0.132231
feces0.121763
state of michigan0.116788
texas0.113821
digestive system0.111732
farm0.111732
mus musculus0.109439
stomach0.109339
mouse0.102356
caecum0.099174
oncorhynchus mykiss0.099174
rainbow trout0.099174
fish0.090615
pseudomyrmex flavicornis0.084034
liolaemus ruibali0.084034
pseudomyrmex nigrocinctus0.084034
wild0.083916
soybean0.080645
argentina0.080645
depth 0-20cm0.079470
glycine max0.077519
sweden0.071006
fish feed0.069565
alouatta palliata0.069565
mantled howler monkey0.069565
nile tilapia0.068376
small intestine0.068376
cold environment0.068376
pseudomyrmex spinicola0.068376
india0.067606
LOWER IN fasting0.067227
oreochromis niloticus0.066116
duodenum0.066116
LOWER IN feces0.064000
female0.063391
early timepoints0.062992
LOWER IN late timepoints0.062992
bos taurus0.060150
homo sapiens0.059657
jejunum0.052863
england0.052174
12c0.052174
dermanyssus gallinae0.052174
red poulty mite0.052174
poulty farm0.052174
holstein-friesian bull0.052174
nouabale-ndoki national park0.052174
republic of congo0.052174
nanger granti0.052174
kenya0.052174
tropical grassland biome0.052174
gazelle0.052174
crematogaster0.050847
zoological garden0.050420
LOWER IN caecum0.049587
ireland0.049587
ileum0.048980
age 4 weeks0.048387
pair of nares0.047809
state of minnesota0.047244
czech republic0.046154
united kingdom0.044118
child0.041812
rumen0.041379
skin0.040134
intestine0.035503
centris atripes0.035398
chlorocebus aethiops0.035398
vervet monkey0.035398
age 6-10 weeks0.035398
pseudomyrmex nigropilosus0.035398
gastrointestinal system mucosa0.035398
LOWER IN warm temperature habitat0.035398
guanacaste conservation area0.035398
root structure0.035398
gut content0.035398
LOWER IN left colon0.035398
age 130.035398
a/j0.035398
central america0.035398
chuquisaca department0.035398
forearm0.035398
LOWER IN right colon0.035088
LOWER IN zoological garden0.035088
age 5-13 years0.034783
arm0.034783
LOWER IN mouth0.034483
south africa0.034483
ethiopia0.034188
food (fermented)0.034188
juvenile organism0.034188
LOWER IN c57bl/60.034188
bolivia0.034188
Fraction of dbbact annotations with this term covered by the query
TermScore
fish feed0.666667
tonsil0.666667
alouatta palliata0.666667
mantled howler monkey0.666667
jejunum0.666667
ant0.500000
pseudomyrmex flavicornis0.500000
catfish0.500000
texas0.500000
caecum0.500000
nile tilapia0.500000
liolaemus ruibali0.500000
small intestine0.500000
centris atripes0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
age 6-10 weeks0.500000
pseudomyrmex nigrocinctus0.500000
england0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
pseudomyrmex nigropilosus0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
pseudomyrmex spinicola0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
guanacaste conservation area0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
root structure0.500000
root nodule0.500000
state of rhode island0.500000
miso food product0.500000
ailurus fulgens0.500000
red panda0.500000
ixodes scapularis0.500000
gut content0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
cyprinus carpio0.500000
common carp0.500000
przewalski horse0.500000
acacia ants0.500000
LOWER IN pseudomyrmex gracilis0.500000
LOWER IN generalist0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
douchi0.500000
holstein-friesian bull0.500000
rumen solids0.500000
LOWER IN rumen liquid0.500000
age 1-3 weeks0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
intestinal contents0.500000
age 12-19 weeks0.500000
skh-1 hairless mouse0.500000
dorsum0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN age 1-3 weeks0.500000
age 130.500000
syncerus caffer caffer0.500000
cape buffalo0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
a/j0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN cefoperazone0.500000
central america0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
bovidae0.500000
hadza0.500000
LOWER IN pan troglodytes troglodytes0.500000
LOWER IN chimpanzee0.500000
gorilla gorilla gorilla0.500000
new delhi0.500000
aepyceros melampus0.500000
impala0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.477064
feces0.266055
research facility0.238532
costa rica0.174312
ant0.155963
larval stage0.137615
pig0.100917
sus scrofa0.100917
digestive system0.091743
farm0.091743
mus musculus0.091743
homo sapiens0.091743
mouse0.082569
stomach0.073394
tonsil0.073394
state of michigan0.073394
texas0.064220
china0.064220
fish0.064220
caecum0.055046
depth 0-20cm0.055046
oncorhynchus mykiss0.055046
rainbow trout0.055046
sweden0.055046
wild0.055046
pseudomyrmex flavicornis0.045872
glycine max0.045872
soybean0.045872
liolaemus ruibali0.045872
argentina0.045872
pseudomyrmex nigrocinctus0.045872
female0.045872
oreochromis niloticus0.036697
nile tilapia0.036697
small intestine0.036697
fish feed0.036697
cold environment0.036697
pseudomyrmex spinicola0.036697
alouatta palliata0.036697
mantled howler monkey0.036697
early timepoints0.036697
LOWER IN fasting0.036697
LOWER IN late timepoints0.036697
duodenum0.036697
LOWER IN feces0.036697
bos taurus0.036697
india0.036697
state of minnesota0.027523
crematogaster0.027523
rhizosphere0.027523
age 4 weeks0.027523
england0.027523
intestine0.027523
12c0.027523
LOWER IN caecum0.027523
dermanyssus gallinae0.027523
red poulty mite0.027523
czech republic0.027523
poulty farm0.027523
zoological garden0.027523
adult0.027523
jejunum0.027523
ileum0.027523
rumen0.027523
holstein-friesian bull0.027523
ireland0.027523
pair of nares0.027523
united kingdom0.027523
control0.027523
skin0.027523
nouabale-ndoki national park0.027523
republic of congo0.027523
nanger granti0.027523
kenya0.027523
tropical grassland biome0.027523
gazelle0.027523
child0.027523
centris atripes0.018349
monkey0.018349
ethiopia0.018349
chlorocebus aethiops0.018349
vervet monkey0.018349
age 6-10 weeks0.018349
pseudomyrmex nigropilosus0.018349
gastrointestinal system mucosa0.018349
LOWER IN warm temperature habitat0.018349
guanacaste conservation area0.018349
shelled egg0.018349
root structure0.018349
root0.018349
food (fermented)0.018349
gut content0.018349
LOWER IN right colon0.018349
LOWER IN left colon0.018349
LOWER IN stomach0.018349
c57bl/6j0.018349
LOWER IN control0.018349
colon0.018349
LOWER IN colon0.018349
felis catus0.018349
Exp. ID User ID Description Date Region Flag Sequences
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
408amnondominant ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 8
108amnondominant research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
271amnondominant depth 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 9
71amnondominant liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
255amnoncommon in fish feed (dominant united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 10
59amnondominant centris atripes, digestive system2017-02-03v4No1 / 11
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 11
388amnondominant pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 11
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 11
71amnondominant liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
396amnondominant fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 12
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 12
408amnondominant ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 12
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 12
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
408amnondominant ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 15
625amnondominant feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 16
180amnondominant dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 17
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 17
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 18
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
271amnoncommon depth 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 22
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum mus musculus mouse )2017-04-07v4No1 / 29
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
71amnoncommon liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 33
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
408amnon high in pseudomyrmex spinicola acacia ants pseudomyrmex nigrocinctus pseudomyrmex flavicornis compared to pseudomyrmex gracilis generalist in ant costa rica united states of america pseudomyrmex 2018-11-22v4No1 / 53
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 59
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 67
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 120
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 196
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 270
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
625amnoncommon feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 309
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
620amnon high in gorilla gorilla compared to pan troglodytes troglodytes chimpanzee in nouabale-ndoki national park republic of congo wild feces 2020-05-06v4No1 / 351
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v4No1 / 368
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
559amnoncommon feces, united states of america, black rhinoceros, diceros bicornis, captive, zoological garden2019-11-03v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 643
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856

Problems / suggestions? Please email info AT dbbact DOT org