Search result for sequence:
GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTTCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG
common ontology terms
term enrichment score
TermScore
ant0.246377
united states of america0.183406
larval stage0.177515
costa rica0.165049
pig0.160584
sus scrofa0.160584
research facility0.156028
tonsil0.137931
farm0.123839
state of michigan0.121212
texas0.118644
digestive system0.116618
stomach0.115385
feces0.114970
mus musculus0.114943
mouse0.107784
oncorhynchus mykiss0.103448
rainbow trout0.103448
fish0.098246
depth 0-20cm0.089552
pseudomyrmex flavicornis0.087719
liolaemus ruibali0.087719
pseudomyrmex nigrocinctus0.087719
soybean0.084034
argentina0.084034
glycine max0.080645
sweden0.075949
fish feed0.072727
nile tilapia0.071429
small intestine0.071429
cold environment0.071429
pseudomyrmex spinicola0.071429
caecum0.070588
india0.070588
LOWER IN fasting0.070175
oreochromis niloticus0.068966
duodenum0.068966
female0.068259
LOWER IN feces0.067227
early timepoints0.065574
LOWER IN late timepoints0.065574
homo sapiens0.063949
bos taurus0.063492
jejunum0.055300
england0.054545
12c0.054545
dermanyssus gallinae0.054545
red poulty mite0.054545
poulty farm0.054545
holstein-friesian bull0.054545
nanger granti0.054545
kenya0.054545
tropical grassland biome0.054545
gazelle0.054545
zoological garden0.053571
crematogaster0.053097
LOWER IN caecum0.052632
ileum0.051724
ireland0.051724
state of minnesota0.050420
age 4 weeks0.050420
pair of nares0.050420
czech republic0.048000
united kingdom0.045802
child0.044776
rumen0.042857
skin0.042403
intestine0.038710
centris atripes0.037037
chlorocebus aethiops0.037037
vervet monkey0.037037
age 6-10 weeks0.037037
pseudomyrmex nigropilosus0.037037
gastrointestinal system mucosa0.037037
LOWER IN warm temperature habitat0.037037
root structure0.037037
gut content0.037037
LOWER IN left colon0.037037
age 130.037037
a/j0.037037
central america0.037037
alouatta palliata0.037037
mantled howler monkey0.037037
chuquisaca department0.037037
forearm0.037037
LOWER IN right colon0.036697
south africa0.036364
age 5-13 years0.036364
arm0.036364
LOWER IN mouth0.036036
ethiopia0.035714
food (fermented)0.035714
juvenile organism0.035714
LOWER IN c57bl/60.035714
bolivia0.035714
shelled egg0.035088
c57bl/6j0.035088
mucus0.034483
LOWER IN stomach0.033898
LOWER IN colon0.033898
Fraction of dbbact annotations with this term covered by the query
TermScore
fish feed0.666667
tonsil0.666667
jejunum0.666667
ant0.500000
pseudomyrmex flavicornis0.500000
catfish0.500000
texas0.500000
nile tilapia0.500000
liolaemus ruibali0.500000
small intestine0.500000
centris atripes0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
age 6-10 weeks0.500000
pseudomyrmex nigrocinctus0.500000
england0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
pseudomyrmex nigropilosus0.500000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
pseudomyrmex spinicola0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
dermanyssus gallinae0.500000
red poulty mite0.500000
poulty farm0.500000
root structure0.500000
root nodule0.500000
state of rhode island0.500000
miso food product0.500000
ailurus fulgens0.500000
red panda0.500000
tick0.500000
ixodes scapularis0.500000
gut content0.500000
LOWER IN transverse colon0.500000
LOWER IN left colon0.500000
cyprinus carpio0.500000
common carp0.500000
przewalski horse0.500000
acacia ants0.500000
LOWER IN pseudomyrmex gracilis0.500000
LOWER IN generalist0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
douchi0.500000
holstein-friesian bull0.500000
rumen solids0.500000
LOWER IN rumen liquid0.500000
age 1-3 weeks0.500000
bathroom0.500000
shower0.500000
tile0.500000
building wall0.500000
intestinal contents0.500000
age 12-19 weeks0.500000
skh-1 hairless mouse0.500000
dorsum0.500000
LOWER IN common carp0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN age 1-3 weeks0.500000
age 130.500000
syncerus caffer caffer0.500000
cape buffalo0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
a/j0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN cefoperazone0.500000
central america0.500000
alouatta palliata0.500000
mantled howler monkey0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
bovidae0.500000
hadza0.500000
new delhi0.500000
aepyceros melampus0.500000
impala0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN restricted diet0.500000
india0.428571
LOWER IN fasting0.400000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.500000
research facility0.250000
feces0.230769
ant0.163462
costa rica0.163462
larval stage0.144231
pig0.105769
sus scrofa0.105769
digestive system0.096154
farm0.096154
mus musculus0.096154
homo sapiens0.096154
mouse0.086538
stomach0.076923
tonsil0.076923
state of michigan0.076923
texas0.067308
china0.067308
fish0.067308
caecum0.057692
depth 0-20cm0.057692
oncorhynchus mykiss0.057692
rainbow trout0.057692
sweden0.057692
pseudomyrmex flavicornis0.048077
glycine max0.048077
soybean0.048077
liolaemus ruibali0.048077
argentina0.048077
pseudomyrmex nigrocinctus0.048077
female0.048077
oreochromis niloticus0.038462
nile tilapia0.038462
small intestine0.038462
fish feed0.038462
cold environment0.038462
pseudomyrmex spinicola0.038462
early timepoints0.038462
LOWER IN fasting0.038462
LOWER IN late timepoints0.038462
duodenum0.038462
LOWER IN feces0.038462
bos taurus0.038462
india0.038462
state of minnesota0.028846
crematogaster0.028846
rhizosphere0.028846
age 4 weeks0.028846
england0.028846
intestine0.028846
12c0.028846
LOWER IN caecum0.028846
dermanyssus gallinae0.028846
red poulty mite0.028846
czech republic0.028846
poulty farm0.028846
zoological garden0.028846
adult0.028846
jejunum0.028846
ileum0.028846
rumen0.028846
holstein-friesian bull0.028846
ireland0.028846
pair of nares0.028846
united kingdom0.028846
control0.028846
skin0.028846
nanger granti0.028846
kenya0.028846
tropical grassland biome0.028846
gazelle0.028846
child0.028846
centris atripes0.019231
monkey0.019231
ethiopia0.019231
chlorocebus aethiops0.019231
vervet monkey0.019231
age 6-10 weeks0.019231
pseudomyrmex nigropilosus0.019231
gastrointestinal system mucosa0.019231
LOWER IN warm temperature habitat0.019231
shelled egg0.019231
root structure0.019231
root0.019231
food (fermented)0.019231
gut content0.019231
LOWER IN right colon0.019231
LOWER IN left colon0.019231
LOWER IN stomach0.019231
c57bl/6j0.019231
LOWER IN control0.019231
colon0.019231
LOWER IN colon0.019231
felis catus0.019231
mucus0.019231
LOWER IN mouth0.019231
LOWER IN soil0.019231
obsolete_juvenile stage0.019231
age 130.019231
juvenile organism0.019231
Exp. ID User ID Description Date Region Flag Sequences
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
408amnonhighfreq ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 8
108amnonhighfreq research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
271amnonhighfreq depth 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 9
71amnonhighfreq liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
255amnoncommon in fish feed (highfreq united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 10
59amnonhighfreq centris atripes, digestive system2017-02-03v4No1 / 11
274amnonhighfreq monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 11
388amnonhighfreq pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
389amnonhighfreq pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 11
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 11
71amnonhighfreq liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
108amnoncommon research facility, texas, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
396amnonhighfreq fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 12
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 12
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 12
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 12
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
408amnonhighfreq ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-10v4No1 / 14
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, larval stage2018-11-22v4No1 / 15
180amnonhighfreq dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 17
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex nigrocinctus, larval stage2018-11-22v4No1 / 17
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, larval stage2018-11-22v4No1 / 18
408amnoncommon ant, costa rica, united states of america, crematogaster, larval stage2018-11-22v4No1 / 19
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
271amnoncommon depth 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, larval stage2018-11-22v4No1 / 22
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum mus musculus mouse )2017-04-07v4No1 / 29
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
71amnoncommon liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 33
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
408amnon high in pseudomyrmex spinicola acacia ants pseudomyrmex nigrocinctus pseudomyrmex flavicornis compared to pseudomyrmex gracilis generalist in ant costa rica united states of america pseudomyrmex 2018-11-22v4No1 / 53
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 59
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 67
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
199amnoncommon on shower wall tile (common bathroom, shower, building, tile, urban biome, united states of america, building wall)2017-10-01v4No1 / 90
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
271amnon high in root structure root compared to soil rhizosphere in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 120
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in research facility texas united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, larval stage, shelled egg2017-08-14v4No1 / 158
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 236
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 270
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
559amnoncommon zoological garden, captive, diceros bicornis, black rhinoceros, united states of america, feces2019-11-03v4No1 / 382
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 643
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 814
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856

Problems / suggestions? Please email info AT dbbact DOT org