Search result for sequence:
GACAGAGGTGGCGAGCGTTGTTCGGAATTACTGGGCTTAAAGGGCGAGTAGGCGGTAGAGCAAGTCCAAGGTGGAATCCTATGGCTCAACCATAGAATTGCCTTGGAAACTGTTTTACTTGAGTCAGTGAGGGGAGGGCAGAATTCCTGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
shenzhen futian national nature reserve0.500000
bodega bay0.500000
spartina alterniflora0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
zostera marina0.333333
marine eelgrass0.333333
zhejiang province0.166667
marine sediment0.142857
depth 0-20cm0.142857
LOWER IN root0.090909
ocean0.062500
state of california0.052632
sediment0.043478
rhizosphere0.030303
china0.018868
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.923077
china0.846154
mangrove swamp0.846154
soil0.769231
depth 0-20cm0.769231
mangrove0.384615
hainan autonomous prefecture0.307692
kandelia candel0.307692
mudflat0.230769
zhejiang province0.230769
futian national nature reserve0.230769
guangdong province0.230769
spartina alterniflora0.153846
danzhou xinyinggang nature reserve0.153846
dongzhaigang national nature reserve0.153846
shenzhen futian national nature reserve0.153846
state of california0.153846
bodega bay0.153846
ocean0.153846
zostera marina0.153846
marine eelgrass0.153846
sediment0.153846
rhizophora stylosa0.076923
rhizosphere0.076923
leizhou nature reserve0.076923
LOWER IN root0.076923
Exp. ID User ID Description Date Region Flag Sequences
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745

Problems / suggestions? Please email info AT dbbact DOT org