Search result for sequence:
GACGAACCGTACAAACGTTACTCGGAATTACTGGGCTTAAAGGGTGCGTAGGCTGCGCGGAAAGTTGGGTGTGAAAGCCCTCAGCTCAACTGGGGAATTGCATTCAAAACTACCGTGCTCGAGGGAGACAGAGGTAAGCGGAACTCAAGG
common ontology terms
term enrichment score
TermScore
mississippi river0.421053
particle0.387097
river0.358974
fresh water0.357143
lake erie0.352941
jiulong river0.352941
fujian province0.352941
freshwater lake0.300000
depth 0.5m0.300000
aquatic biome0.266667
depth 1m0.266667
filtered 2.7um0.235294
lake0.230769
LOWER IN dry season0.173913
wet season0.173913
near shore0.153846
LOWER IN offshore0.153846
algal bloom0.153846
lower mississippi river0.153846
LOWER IN upper mississippi river0.153846
LOWER IN filtered 0.2um0.153846
LOWER IN autumn0.133333
litopenaeus vannamei0.133333
pacific white shrimp0.133333
downstream0.133333
LOWER IN upstream0.133333
LOWER IN free floating0.133333
free floating0.125000
water0.119701
LOWER IN winter0.108108
autumn0.105263
summer0.093023
intestine0.071429
farm0.060606
china0.044199
united states of america0.031963
LOWER IN control0.015385
Fraction of dbbact annotations with this term covered by the query
TermScore
particle0.666667
lake erie0.500000
near shore0.500000
LOWER IN offshore0.500000
algal bloom0.500000
jiulong river0.500000
fujian province0.500000
mississippi river0.500000
aquatic biome0.500000
depth 1m0.500000
lower mississippi river0.500000
LOWER IN upper mississippi river0.500000
LOWER IN filtered 0.2um0.500000
freshwater lake0.333333
depth 0.5m0.333333
filtered 2.7um0.333333
river0.250000
LOWER IN autumn0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
downstream0.250000
LOWER IN upstream0.250000
LOWER IN free floating0.250000
fresh water0.222222
lake0.200000
free floating0.200000
LOWER IN dry season0.166667
wet season0.166667
autumn0.125000
LOWER IN winter0.076923
water0.065217
summer0.062500
intestine0.058824
farm0.045455
china0.023529
united states of america0.016393
LOWER IN control0.008403
Fraction of annotations for the query sequences containing the term
TermScore
fresh water0.909091
water0.727273
united states of america0.636364
river0.636364
china0.363636
mississippi river0.363636
lake0.272727
lake erie0.272727
freshwater lake0.272727
depth 0.5m0.272727
jiulong river0.272727
fujian province0.272727
particle0.272727
summer0.181818
LOWER IN winter0.181818
LOWER IN dry season0.181818
wet season0.181818
aquatic biome0.181818
depth 1m0.181818
filtered 2.7um0.181818
near shore0.090909
LOWER IN offshore0.090909
algal bloom0.090909
LOWER IN control0.090909
autumn0.090909
LOWER IN autumn0.090909
farm0.090909
litopenaeus vannamei0.090909
pacific white shrimp0.090909
intestine0.090909
free floating0.090909
lower mississippi river0.090909
downstream0.090909
LOWER IN upper mississippi river0.090909
LOWER IN upstream0.090909
LOWER IN free floating0.090909
LOWER IN filtered 0.2um0.090909
Exp. ID User ID Description Date Region Flag Sequences
226amnonlower in offshore station compared to near shore station ( high in near shore compared to offshore in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 106
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 301
226amnoncommon water, lake, lake erie, united states of america, freshwater lake, fresh water2017-10-29v4No1 / 316
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, particle2017-04-05v4No1 / 909
103amnoncommon river, united states of america, mississippi river, fresh water, aquatic biome, free floating2017-04-05v4No1 / 909
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in mississippi river water river fresh water depth 1m united states of america particle filtered 2.7um )2019-01-07v4No1 / 1418
443amnon high in particle filtered 2.7um compared to free floating filtered 0.2um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 2266

Problems / suggestions? Please email info AT dbbact DOT org