Search result for sequence:
GACGAACCGTCCAAACGTTATTCGGTATCACTGGGCTTAAAGCGTGCGTAGGCGGCTTGGTAGGTGAGATGTGAAAGCCCACGGCTCAACCGTGGAATTGCGTTTCAAACCCCCAAGCTCGAGGAAGATAGGGGTGATGGGAACTTATGG
common ontology terms
term enrichment score
TermScore
pacific ocean0.584071
marine sediment0.392811
ocean0.380000
ocean water0.361757
monterey bay0.319018
saline water0.309278
sediment0.285375
state of california0.259887
water0.236620
sea water0.222222
beach0.138889
north east pacific ocean0.138889
oil seep0.129870
bodega bay0.114286
atlantic ocean0.112150
hawaii0.111111
depth 200m0.090909
depth 4000m0.090226
depth 20m0.088235
north america0.088235
depth 25cm0.088235
nan'ao island0.088235
zostera marina0.084507
marine eelgrass0.084507
surface water0.081081
sand0.077922
canada0.075000
depth 500-1000m0.061538
portuguese republic0.060606
siganidae0.060606
rabbitfish0.060606
depth 4m0.060606
pearl harbor0.060606
hydroides elegans0.060606
tubeworm0.060606
aerosol0.060606
shore0.060606
depth 150m0.060606
particle bound0.060606
size 1-80um0.060606
continental shelf0.060606
depth 400-800m0.060606
santa cruz province0.060606
red alga0.060606
depth 50-100m0.060606
brackish water0.060606
caspian sea0.060606
marine water body0.058824
lytechinus variegatus0.058824
antarctica0.058824
mastocarpus0.058824
depth 1000-2000m0.058824
vancouver0.057143
LOWER IN sea water0.055556
florida0.054054
air0.048780
LOWER IN water0.047619
australia0.043478
LOWER IN coral reef0.031250
LOWER IN coral0.031250
LOWER IN eunicella labiata0.031250
LOWER IN gorgonian coral0.031250
cape cod canal0.031250
LOWER IN vancouver0.031250
LOWER IN pacific ocean0.031250
depth 10m0.031250
bilbao0.031250
estuary0.031250
estuary water0.031250
salinity >20 ppt0.031250
LOWER IN salinity <5 ppt0.031250
saanich inlet0.031250
depth 30m0.031250
indian ocean0.031250
depth 40m0.031250
depth 60m0.031250
philippine sea0.031250
depth 80m0.031250
juan de fuca nehalem0.031250
LOWER IN megaptera novaeangliae0.031250
LOWER IN humpback whale0.031250
LOWER IN respiratory airway0.031250
LOWER IN whale blow0.031250
LOWER IN exhaled air condensate0.031250
LOWER IN depth 8-10cm0.031250
depth 500m0.031250
tubeworm tube0.031250
clayoquot slope0.031250
LOWER IN nereocystis0.031250
LOWER IN kelp0.031250
south florida0.031250
LOWER IN shark0.031250
barkley canyon0.031250
LOWER IN depth 150-500m0.031250
endeavour0.031250
LOWER IN size < 1um0.031250
hecceta sw0.031250
depth 150-600m0.031250
sample depth 0-12cm0.031250
LOWER IN depth 5-50m0.031250
Fraction of dbbact annotations with this term covered by the query
TermScore
depth 200m0.750000
marine sediment0.692308
monterey bay0.666667
depth 4000m0.666667
depth 500-1000m0.666667
pacific ocean0.647059
depth 20m0.500000
portuguese republic0.500000
LOWER IN coral reef0.500000
LOWER IN coral0.500000
LOWER IN eunicella labiata0.500000
LOWER IN gorgonian coral0.500000
ocean0.500000
north america0.500000
depth 25cm0.500000
cape cod canal0.500000
LOWER IN vancouver0.500000
LOWER IN pacific ocean0.500000
siganidae0.500000
rabbitfish0.500000
depth 10m0.500000
depth 4m0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity >20 ppt0.500000
LOWER IN salinity <5 ppt0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
beach0.500000
aerosol0.500000
saanich inlet0.500000
depth 30m0.500000
indian ocean0.500000
depth 40m0.500000
shore0.500000
depth 60m0.500000
philippine sea0.500000
depth 150m0.500000
particle bound0.500000
size 1-80um0.500000
nan'ao island0.500000
depth 80m0.500000
continental shelf0.500000
depth 400-800m0.500000
bodega bay0.500000
santa cruz province0.500000
north east pacific ocean0.500000
juan de fuca nehalem0.500000
LOWER IN megaptera novaeangliae0.500000
LOWER IN humpback whale0.500000
LOWER IN respiratory airway0.500000
LOWER IN whale blow0.500000
LOWER IN exhaled air condensate0.500000
LOWER IN depth 8-10cm0.500000
depth 500m0.500000
red alga0.500000
tubeworm tube0.500000
clayoquot slope0.500000
LOWER IN nereocystis0.500000
LOWER IN kelp0.500000
south florida0.500000
LOWER IN shark0.500000
barkley canyon0.500000
depth 50-100m0.500000
LOWER IN depth 150-500m0.500000
endeavour0.500000
LOWER IN size < 1um0.500000
hecceta sw0.500000
brackish water0.500000
caspian sea0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
LOWER IN depth 5-50m0.500000
sample depth 12-35cm0.500000
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
low activity methane seep0.500000
LOWER IN oil seep0.500000
LOWER IN active methane seep0.500000
LOWER IN air0.500000
LOWER IN polymetallic nodule0.500000
atlantic ocean0.428571
saline water0.428571
ocean water0.411765
hawaii0.400000
sea water0.357143
sediment0.347826
marine water body0.333333
south china sea0.333333
coral reef0.333333
digesta0.333333
lytechinus variegatus0.333333
antarctica0.333333
zostera marina0.333333
marine eelgrass0.333333
depth 100m0.333333
oil seep0.333333
Fraction of annotations for the query sequences containing the term
TermScore
pacific ocean0.532258
state of california0.370968
water0.338710
ocean water0.322581
ocean0.306452
marine sediment0.274194
saline water0.241935
sediment0.241935
monterey bay0.209677
sea water0.161290
united states of america0.129032
beach0.080645
north east pacific ocean0.080645
oil seep0.080645
atlantic ocean0.064516
hawaii0.064516
bodega bay0.064516
depth 20m0.048387
north america0.048387
depth 25cm0.048387
canada0.048387
depth 200m0.048387
surface water0.048387
china0.048387
nan'ao island0.048387
zostera marina0.048387
marine eelgrass0.048387
depth 4000m0.048387
sand0.048387
portuguese republic0.032258
marine water body0.032258
siganidae0.032258
rabbitfish0.032258
australia0.032258
depth 4m0.032258
pearl harbor0.032258
research facility0.032258
hydroides elegans0.032258
tubeworm0.032258
air0.032258
aerosol0.032258
lytechinus variegatus0.032258
florida0.032258
shore0.032258
depth 150m0.032258
particle bound0.032258
size 1-80um0.032258
antarctica0.032258
continental shelf0.032258
depth 400-800m0.032258
santa cruz province0.032258
vancouver0.032258
red alga0.032258
mastocarpus0.032258
depth 1000-2000m0.032258
depth 500-1000m0.032258
depth 50-100m0.032258
brackish water0.032258
caspian sea0.032258
LOWER IN water0.032258
LOWER IN sea water0.032258
LOWER IN coral reef0.016129
LOWER IN coral0.016129
LOWER IN eunicella labiata0.016129
LOWER IN gorgonian coral0.016129
cape cod canal0.016129
LOWER IN vancouver0.016129
LOWER IN pacific ocean0.016129
midgut0.016129
hindgut0.016129
depth 10m0.016129
south china sea0.016129
coast0.016129
coral reef0.016129
depth 5m0.016129
kingdom of spain0.016129
bilbao0.016129
estuary0.016129
estuary water0.016129
salinity >20 ppt0.016129
LOWER IN fresh water0.016129
LOWER IN salinity <5 ppt0.016129
egg0.016129
saanich inlet0.016129
depth 30m0.016129
digesta0.016129
indian ocean0.016129
depth 40m0.016129
feces0.016129
depth 60m0.016129
philippine sea0.016129
depth 80m0.016129
LOWER IN sediment0.016129
LOWER IN marine sediment0.016129
root0.016129
depth 100m0.016129
juan de fuca nehalem0.016129
LOWER IN megaptera novaeangliae0.016129
LOWER IN humpback whale0.016129
LOWER IN respiratory airway0.016129
Exp. ID User ID Description Date Sequences
280amnon high in marine water body sea water saline water compared to coral reef coral eunicella labiata gorgonian coral in atlantic ocean depth 20m portuguese republic 2018-01-251 / 132
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth 25cm 2017-10-151 / 166
159amnoncommon siganidae, rabbitfish, australia, midgut2017-07-061 / 169
159amnoncommon siganidae, rabbitfish, hindgut, australia2017-07-061 / 208
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 10m2019-01-161 / 213
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-191 / 215
418amnoncommon ocean, sediment, coral reef2018-12-021 / 216
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 5m2019-01-161 / 220
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-201 / 223
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 20m2019-01-161 / 225
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, egg2019-02-131 / 243
235amnoncommon in sediment near eelgrass in northern hemisphere (common sediment, marine sediment, ocean)2017-11-071 / 258
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-251 / 259
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-121 / 263
496amnoncommon water, ocean water, canada, saanich inlet, pacific ocean, depth 200m2019-03-031 / 287
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 30m2019-01-161 / 293
65amnoncommon digesta, lytechinus variegatus, florida2017-02-171 / 298
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-191 / 333
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 40m2019-01-161 / 340
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-121 / 345
65amnoncommon feces, lytechinus variegatus, florida2017-02-171 / 376
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 60m2019-01-161 / 390
342amnoncommon water, ocean water, pacific ocean, philippine sea, depth 150m2018-05-281 / 397
505amnoncommon water, ocean water, pacific ocean, state of california, surface water, particle bound, size 1-80um2019-03-141 / 397
504amnoncommon china, nan'ao island, sediment, marine sediment2019-03-141 / 437
209amnoncommon sea water, ocean, north america, depth 25cm2017-10-151 / 445
504amnoncommon china, nan'ao island, water, ocean water, sea water2019-03-141 / 452
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 80m2019-01-161 / 454
504amnon high in water sea water ocean water compared to sediment marine sediment in china nan'ao island 2019-03-141 / 462
142amnoncommon in cruise 2 (western antarctica) (common marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-191 / 468
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-071 / 483
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 100m2019-01-161 / 486
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 200m2019-01-161 / 492
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-121 / 518
472amnoncommon ocean, sediment, marine sediment, pacific ocean, north east pacific ocean, oil seep, depth 150m, juan de fuca nehalem2019-01-161 / 535
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-151 / 560
139amnonnegatively correlated with sediment depth (in ocean floor depth 4000m) ( high in depth 0-5cm compared to depth 8-10cm in pacific ocean depth 4000m marine sediment )2017-04-181 / 565
473amnoncommon water, saline water, ocean water, pacific ocean, state of california, monterey bay, depth 500m2019-01-161 / 587
318amnoncommon canada, vancouver, ocean, pacific ocean, red alga, mastocarpus2018-04-161 / 598
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-131 / 683
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 1000-2000m, clayoquot slope2019-01-161 / 725
142amnoncommon in cruise 1 (western antarctica) (common marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-191 / 756
318amnon high in mastocarpus red alga compared to nereocystis kelp in canada vancouver ocean pacific ocean 2018-04-161 / 827
323amnonlower in sharks compared to sea water ( high in water ocean water surface water depth 0m compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-241 / 979
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 500-1000m, barkley canyon2019-01-161 / 990
473amnon high in depth 50-100m compared to depth 150-500m in water saline water ocean water pacific ocean state of california monterey bay 2019-01-161 / 1072
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-121 / 1151
236amnoncommon ocean, ocean water, state of california, pacific ocean, bodega bay, water2017-11-071 / 1156
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth 2000-3000m, endeavour2019-01-161 / 1205
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water ocean water pacific ocean state of california surface water 2019-03-141 / 1218
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth 1000-2000m2019-01-161 / 1275
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-181 / 1549
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-121 / 1599
473amnon high in depth 50-100m compared to depth 5-50m in water saline water ocean water pacific ocean state of california monterey bay 2019-01-161 / 1656
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-181 / 1659
138amnoncommon pacific ocean, depth 4000m, marine sediment2017-04-181 / 1753
486amnon high in low activity methane seep compared to oil seep active methane seep in pacific ocean ocean sediment carbonate lithified carbonate blocks depth 500-1000m hydrate ridge state of oregon 2019-02-191 / 1791
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-121 / 1838
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-071 / 1904
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-121 / 2070
139amnon high in marine sediment compared to polymetallic nodule in pacific ocean depth 4000m 2017-04-181 / 2686
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-071 / 2745

Problems / suggestions? Please email info AT dbbact DOT org