Search result for sequence:
GACGAACCGTGCGAACGTTGTTCGGAATCACTGGGCTTAAAGGGCGCGTAGGCGGCTTGCCAAGTCAGTGGTGAAATCCCGCAGCTTAACTGCGGAAGTGCCTTTGATACTGGCGAGCTCGAGGGAGGTAGGGGTATGTGGAACTTCTGG
common ontology terms
term enrichment score
TermScore
soil0.334113
alabama0.259259
ultisol0.259259
auburn0.229508
depth (soil) 0-10cm0.228471
topsoil0.224299
dekalb county0.215686
illinois0.215686
forest ecosystem0.195122
upland soil0.166667
state of illinois0.130952
foot slope 0.130435
hapludalf0.130435
alfisol0.130435
sandy loam0.122449
sandy loam soil0.122449
agricultural field0.112903
peat soil0.111111
minas gerais state0.111111
campos rupestres0.111111
kellogg biological station0.111111
mesic type hapludalf0.111111
kalamazoo loam0.111111
mollisol0.105263
fen0.093023
mesocosm0.090909
depth 50-100m0.090909
silt loam0.090909
woodland area0.089172
forested area0.088889
brazil0.087591
state of idaho0.086957
state of michigan0.076923
rhizosphere0.072072
state of georgia0.071429
LOWER IN depth (soil) 25-50cm0.071006
depth (soil) 10-25cm0.071006
temperate grassland biome0.069767
permafrost0.069767
lushan mountain0.069767
olympic national park0.069767
miscanthus0.069767
restored prairie0.069767
panicum virgatum0.069767
elevation 2000-3000m0.069767
depth 50-70cm0.069767
peatland0.067416
province of quebec0.067416
corn0.067416
mountain0.067416
state of washington0.063158
jiangxi province0.061224
root0.058537
switzerland0.056075
united kingdom0.051724
depth (soil) 0-20cm0.049383
park0.048193
depth (soil) 25-50cm0.048193
flooded grassland biome0.047619
taxus0.047619
taxus mairei0.047619
ph 40.047619
ph 5.50.047619
svalbard archipelago0.047619
temperate woodland biome0.047619
temperate deciduos forest0.047619
subpolar coniferous forest biome0.047619
boreal forest0.047619
hani peatland0.047619
baekdudaegan0.047619
vellozia epidendroides0.047619
epiphytic material0.047619
intact branch0.047619
canopy soil0.047619
siliceous parent material0.047619
canton of graubunden0.047619
depth 0-12cm0.047619
depth 44-108cm0.047619
LOWER IN depth 12-44cm0.047619
tundra0.047059
coniferous forest biome0.046512
depth (soil) 15-30cm0.046512
depth (soil) 20-30cm0.045455
depth 5cm0.044444
united states of america0.043456
kingdom of norway0.041667
tree0.040000
canada0.035294
ph 5-60.035088
plant0.032258
china0.027362
cuticle0.024691
chitin-based cuticle0.024691
atlantic rainforest0.024691
parque estadual serra do mar-núcleo picinguaba0.024691
odontomachus hastatus0.024691
sao paulo state0.024691
volcan sumaco0.024691
central park0.024390
southeast china0.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
volcan sumaco1.000000
fen0.666667
park0.666667
depth (soil) 25-50cm0.666667
LOWER IN depth (soil) 25-50cm0.666667
depth (soil) 10-25cm0.666667
peat soil0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
central park0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
permafrost0.500000
pinus sibirica0.500000
pine forest0.500000
ph 40.500000
LOWER IN soilwater0.500000
soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
svalbard archipelago0.500000
LOWER IN permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
ph 5.40.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph>30.500000
LOWER IN ph<30.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
montane forest0.500000
mediterranean forest biome0.500000
reunion island0.500000
hani peatland0.500000
baekdudaegan0.500000
LOWER IN riganqiao peatland0.500000
LOWER IN ph 5.5-6.50.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
elevation 500-600m0.500000
lushan mountain0.500000
elevation 1000-1100m0.500000
elevation 1300-1400m0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
epiphytic material0.500000
LOWER IN severed branch0.500000
intact branch0.500000
olympic national park0.500000
canopy soil0.500000
temperate rainforest0.500000
depth 50-100m0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
miscanthus0.500000
restored prairie0.500000
panicum virgatum0.500000
LOWER IN gaster0.500000
tropical moist broadleaf forest biome0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
oak0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
depth 50-70cm0.500000
depth 70-100cm0.500000
LOWER IN depth 70-100cm0.500000
foot slope 0.500000
depth 30-50cm0.500000
depth 50-90cm0.500000
depth 90-100cm0.500000
LOWER IN depth 50-90cm0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.850000
united states of america0.350000
auburn0.175000
alabama0.175000
agricultural field0.175000
ultisol0.175000
depth (soil) 0-10cm0.162500
topsoil0.150000
dekalb county0.137500
illinois0.137500
state of illinois0.137500
forest ecosystem0.125000
upland soil0.100000
china0.087500
woodland area0.087500
brazil0.075000
foot slope 0.075000
sandy loam0.075000
sandy loam soil0.075000
hapludalf0.075000
alfisol0.075000
peat soil0.062500
rhizosphere0.062500
minas gerais state0.062500
campos rupestres0.062500
state of michigan0.062500
kellogg biological station0.062500
mesic type hapludalf0.062500
kalamazoo loam0.062500
mollisol0.062500
silt loam0.062500
fen0.050000
state of idaho0.050000
depth (soil) 0-20cm0.050000
forested area0.050000
mesocosm0.050000
state of georgia0.050000
depth 50-100m0.050000
peatland0.037500
temperate grassland biome0.037500
united kingdom0.037500
permafrost0.037500
canada0.037500
province of quebec0.037500
root0.037500
jiangxi province0.037500
lushan mountain0.037500
state of washington0.037500
olympic national park0.037500
corn0.037500
miscanthus0.037500
restored prairie0.037500
panicum virgatum0.037500
LOWER IN depth (soil) 25-50cm0.037500
mountain0.037500
switzerland0.037500
elevation 2000-3000m0.037500
depth (soil) 10-25cm0.037500
depth 50-70cm0.037500
depth 5cm0.025000
flooded grassland biome0.025000
park0.025000
tree0.025000
taxus0.025000
taxus mairei0.025000
tundra0.025000
ph 40.025000
ph 5.50.025000
plant0.025000
kingdom of norway0.025000
svalbard archipelago0.025000
depth (soil) 20-30cm0.025000
temperate woodland biome0.025000
temperate deciduos forest0.025000
subpolar coniferous forest biome0.025000
boreal forest0.025000
hani peatland0.025000
baekdudaegan0.025000
ph 5-60.025000
vellozia epidendroides0.025000
coniferous forest biome0.025000
epiphytic material0.025000
intact branch0.025000
canopy soil0.025000
depth (soil) 25-50cm0.025000
siliceous parent material0.025000
canton of graubunden0.025000
depth (soil) 15-30cm0.025000
depth 0-12cm0.025000
depth 44-108cm0.025000
LOWER IN depth 12-44cm0.025000
sphagnum bog0.012500
wetland area0.012500
depth 20cm0.012500
urban biome0.012500
new york city0.012500
central park0.012500
ph0.012500
ph<60.012500
LOWER IN ph&gt;60.012500
Exp. ID User ID Description Date Region Flag Sequences
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 127
823sheryoHigher in 50-70cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 135
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 390
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
135amnoncommon soil, tundra, alaska, permafrost, depth (soil) 15cm2017-04-17v4No1 / 438
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 442
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 543
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org