Search result for sequence:
GACGAACCGTGCGAACGTTGTTCGGAATCACTGGGCTTAAAGGGCGCGTAGGCGGGCTGTCAAGTCTGGGGTGAAATGCCGCGGCTCAACCGTGGAACTGCCTTAGATACTGACGGCCTCGAGGGAGGTAGGGGCGTGCGGAACTGTAGG
common ontology terms
term enrichment score
TermScore
soil0.385344
agricultural field0.347222
rhizosphere0.281012
zea mays0.229508
silt loam0.229508
depth (soil) 0-10cm0.200000
alabama0.175439
ultisol0.175439
cultivated environment0.166052
auburn0.161290
shaanxi province0.160714
loess plateau0.148760
glycine max0.148148
dekalb county0.145455
illinois0.145455
china0.139595
ph 7-80.134078
triticum aestivum0.129730
depth (soil) 0-20cm0.123203
depth (soil) 0-30 cm0.117647
minas gerais state0.113208
campos rupestres0.113208
state of illinois0.101266
brazil0.100279
topsoil0.099174
forest ecosystem0.099174
black soil0.098522
depth (soil) 0-15cm0.098522
united states0.096154
nicollet soil series0.096154
des moines0.096154
upland soil0.096154
foot slope 0.096154
hapludalf0.096154
alfisol0.096154
ph 70.093897
iowa0.091743
sandy loam0.091743
sandy loam soil0.091743
mollisol0.080000
orchard0.078431
yunwushan national natural grassland protection zone0.078431
ningxia province0.078431
calci-orthic aridisol0.078431
haplic calcisol0.078431
grazing exclusion0.078431
jilin province0.075472
LOWER IN root0.073394
farm0.071301
woodland area0.067114
depth (soil) 15-30cm0.060914
greenhouse soil0.060000
campinas0.060000
subsurface drainage0.060000
kelley0.060000
0-9 years of grazing exclusion0.060000
LOWER IN 10 years0.060000
LOWER IN reforestation0.060000
LOWER IN robinia pseudoacacia0.060000
robinia pseudoacacia0.060000
reforestation0.060000
elevation 2000-3000m0.060000
fertilized soil0.059113
saccharum0.058252
sugarcane0.058252
mountain0.058252
agricultural feature0.055556
tree0.055046
state of tennessee0.055046
greenhouse0.053571
japan0.050209
switzerland0.049587
italy0.047244
cambisol0.041237
heilongjiang province0.041237
loam soil0.041237
taxus0.040816
temperate0.040816
fragaria x ananassa0.040816
strawberry0.040816
yellow brown soil0.040816
continuous cropping0.040816
age 10 years0.040816
vellozia epidendroides0.040816
barbacenia macrantha0.040816
days 30-400.040816
ryegrass0.040816
ames0.040816
LOWER IN depth (soil) 60-90cm0.040816
LOWER IN 20 years0.040816
30 years0.040816
siliceous parent material0.040816
canton of graubunden0.040816
oak0.040816
flood plain0.040816
sacramento0.040816
cosumnes river preserve0.040816
apricot0.040816
prunus armeniaca0.040816
apennine mountains0.040816
Fraction of dbbact annotations with this term covered by the query
TermScore
jinxiang county1.000000
depth (soil) 0-30 cm0.750000
cambisol0.666667
heilongjiang province0.666667
black soil0.666667
mollisol0.666667
depth (soil) 0-15cm0.666667
depth (soil) 15-30cm0.666667
loam soil0.666667
cultivated environment0.625000
glycine max0.571429
temperate grassland biome0.500000
merlot0.500000
grapevine0.500000
taxus0.500000
taxus media0.500000
temperate0.500000
taxus mairei0.500000
north china plain0.500000
ph>5, ph<60.500000
ph 5.40.500000
moist tropical forest0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
montane forest0.500000
mediterranean forest biome0.500000
savanna0.500000
red soil0.500000
zea mays0.500000
orchard0.500000
reunion island0.500000
organic farming0.500000
fragaria x ananassa0.500000
strawberry0.500000
greenhouse soil0.500000
yellow brown soil0.500000
continuous cropping0.500000
age 10 years0.500000
silt loam0.500000
LOWER IN detph 30-75cm0.500000
LOWER IN silt clay loam0.500000
populus0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
LOWER IN stover amended0.500000
campinas0.500000
days 30-400.500000
ryegrass0.500000
citrullus lanatus0.500000
co culture with wheat (triticum aestivum l.)0.500000
inoculated with fusarium oxysporum f. sp. niveum0.500000
united states0.500000
nicollet soil series0.500000
ames0.500000
des moines0.500000
agricultural field0.500000
LOWER IN depth (soil) 60-90cm0.500000
subsurface drainage0.500000
ph 6.20.500000
kelley0.500000
0-9 years of grazing exclusion0.500000
yunwushan national natural grassland protection zone0.500000
ningxia province0.500000
calci-orthic aridisol0.500000
haplic calcisol0.500000
grazing exclusion0.500000
27-35 years of grazing exclusion0.500000
depth 40-60cm0.500000
depth 0-40cm0.500000
shaanxi province0.500000
depth 40-100cm0.500000
depth 100-300cm0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
LOWER IN 20 years0.500000
LOWER IN 30 years0.500000
20 years0.500000
robinia pseudoacacia0.500000
reforestation0.500000
30 years0.500000
orthic anthrosol0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
loam0.500000
neve yaar0.500000
oak0.500000
acute oak decline0.500000
glycine soja0.500000
oryza rufipogon0.500000
bretagne region0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.765957
china0.361702
rhizosphere0.265957
agricultural field0.265957
united states of america0.159574
zea mays0.148936
silt loam0.148936
depth (soil) 0-10cm0.127660
depth (soil) 0-20cm0.106383
auburn0.106383
alabama0.106383
ultisol0.106383
cultivated environment0.095745
brazil0.095745
loess plateau0.095745
shaanxi province0.095745
glycine max0.085106
triticum aestivum0.085106
ph 7-80.085106
dekalb county0.085106
illinois0.085106
state of illinois0.085106
topsoil0.063830
forest ecosystem0.063830
depth (soil) 0-30 cm0.063830
minas gerais state0.063830
campos rupestres0.063830
woodland area0.053191
black soil0.053191
farm0.053191
ph 70.053191
united states0.053191
nicollet soil series0.053191
depth (soil) 0-15cm0.053191
des moines0.053191
iowa0.053191
upland soil0.053191
foot slope 0.053191
sandy loam0.053191
sandy loam soil0.053191
hapludalf0.053191
alfisol0.053191
LOWER IN root0.042553
mollisol0.042553
orchard0.042553
yunwushan national natural grassland protection zone0.042553
ningxia province0.042553
calci-orthic aridisol0.042553
haplic calcisol0.042553
grazing exclusion0.042553
jilin province0.042553
tree0.031915
agricultural feature0.031915
japan0.031915
italy0.031915
greenhouse soil0.031915
state of tennessee0.031915
saccharum0.031915
sugarcane0.031915
campinas0.031915
greenhouse0.031915
subsurface drainage0.031915
kelley0.031915
depth (soil) 15-30cm0.031915
0-9 years of grazing exclusion0.031915
LOWER IN 10 years0.031915
LOWER IN reforestation0.031915
LOWER IN robinia pseudoacacia0.031915
robinia pseudoacacia0.031915
reforestation0.031915
fertilized soil0.031915
mountain0.031915
switzerland0.031915
elevation 2000-3000m0.031915
state of new york0.021277
taxus0.021277
northeast china0.021277
temperate0.021277
cambisol0.021277
heilongjiang province0.021277
citrus0.021277
oryza sativa0.021277
fragaria x ananassa0.021277
strawberry0.021277
yellow brown soil0.021277
nanjing city prefecture0.021277
continuous cropping0.021277
age 5 years0.021277
age 10 years0.021277
vellozia epidendroides0.021277
root0.021277
barbacenia macrantha0.021277
ph 60.021277
days 30-400.021277
ryegrass0.021277
10 cm depth0.021277
jiangsu province0.021277
ames0.021277
LOWER IN depth (soil) 60-90cm0.021277
LOWER IN 20 years0.021277
Exp. ID User ID Description Date Region Flag Sequences
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 442
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
615amnon high in rhizosphere compared to endosphere root in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 913
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org