Search result for sequence:
GACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAAAGGCCCTGCTTTTGTGGGGTGCTCGAGTGGCGAACGGGTGAGTAACACGTGAGTAACCTGCCCTTGACTTTGGGATAACTTCAGGAAACTGGGGCTAATACCGGAT
common ontology terms
term enrichment score
TermScore
soil0.329298
rhizosphere0.289855
citrus0.206573
tick0.201550
cultivated environment0.200000
australia0.180666
depth 0-20cm0.157895
whole body0.153846
agricultural feature0.150943
wheat0.150943
root0.140351
orchard0.134615
body proper0.133333
state of tennessee0.123077
china0.120953
populus0.117647
triticum aestivum0.114286
mexico0.111111
tree0.100000
agave0.100000
glycine max0.100000
north china plain0.100000
united states of america0.087789
guanajuato0.081633
merlot0.081633
grapevine0.081633
leaf0.081081
desert0.080000
state of california0.080000
vitis vinifera0.078431
new york0.078431
state of florida0.078431
river0.075472
skin0.072289
agave salmiana0.062500
depth 0-30cm0.062500
silt loam0.062500
black soil0.062500
mollisol0.062500
foot0.060606
heilongjiang province0.060606
zea mays0.060606
woodland area0.059701
LOWER IN root0.059406
winter0.058824
LOWER IN soil0.055556
kingdom of spain0.054795
wild0.050633
haemaphysalis0.042553
haemaphysalis bancrofti0.042553
ixodes australiensis0.042553
ixodes fecialis0.042553
australian paralysis tick0.042553
ixodes holocyclus0.042553
ixodes ornithorhynchi0.042553
ixodes antechini0.042553
santa catalina island0.042553
urocyon littoralis0.042553
santa catalina island fox0.042553
urocyon littoralis catalinae0.042553
heavy metal0.042553
without plants0.042553
difenoconazole0.042553
fungicide0.042553
tobacco field0.042553
limestone0.042553
non-seleniferous0.042553
triticum aestivum l. cv., xiaoyan no. 220.042553
silty clay0.042553
mississippi river0.042553
depth 5cm0.042105
scotland0.041667
ph<60.041667
npk fertilizer0.041667
state of idaho0.041667
soybean0.041667
ear canal0.040816
external acoustic meatus0.040816
leaf surface0.040816
rice0.040816
bulk soil0.040816
oryza sativa0.040000
biofilm0.039216
drinking water0.038462
ph 7-80.038462
topsoil0.037736
depth 0-10cm0.037037
forest ecosystem0.037037
ixodes tasmani0.021739
bothriocroton concolor0.021739
haemaphysalis humerosa0.021739
southern united states0.021739
fossorial snake0.021739
storeria dekayi0.021739
ground snake0.021739
LOWER IN lip0.021739
LOWER IN labial commissure0.021739
populus trichocarpa x deltoides0.021739
LOWER IN populus deltoides0.021739
LOWER IN perianal skin0.021739
Fraction of dbbact annotations with this term covered by the query
TermScore
citrus0.666667
haemaphysalis0.500000
haemaphysalis bancrofti0.500000
ixodes tasmani0.500000
ixodes australiensis0.500000
ixodes fecialis0.500000
bothriocroton concolor0.500000
australian paralysis tick0.500000
ixodes holocyclus0.500000
haemaphysalis humerosa0.500000
ixodes ornithorhynchi0.500000
ixodes antechini0.500000
agave0.500000
agave salmiana0.500000
guanajuato0.500000
southern united states0.500000
fossorial snake0.500000
storeria dekayi0.500000
ground snake0.500000
santa catalina island0.500000
urocyon littoralis0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
LOWER IN lip0.500000
LOWER IN labial commissure0.500000
merlot0.500000
grapevine0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
LOWER IN perianal skin0.500000
orchard0.500000
immokalee, fl0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
mediterranean forest biome0.500000
LOWER IN gastrointestinal system0.500000
LOWER IN alimentary part of gastrointestinal system0.500000
chub mackerel0.500000
scomber japonicus0.500000
san diego0.500000
heavy metal0.500000
reunion island0.500000
size < 10um0.500000
clear day0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
depth 30-75cm0.500000
silt clay loam0.500000
without plants0.500000
difenoconazole0.500000
fungicide0.500000
tobacco field0.500000
limestone0.500000
depth 0-30cm0.500000
silt loam0.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
quincy, fl0.500000
agricultural feature0.500000
glycine max0.500000
black soil0.500000
mollisol0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph>6, ph<6.50.500000
root zone soil0.500000
epilithic0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
non-seleniferous0.500000
field soil0.500000
nicotiana tabacum0.500000
LOWER IN seleniferous0.500000
LOWER IN outlet0.500000
inlet0.500000
engineered wetland0.500000
benthic biomat0.500000
water treatment pond0.500000
microbial biomat0.500000
biomat0.500000
triticum aestivum l. cv., xiaoyan no. 220.500000
silty clay0.500000
LOWER IN detph 30-75cm0.500000
LOWER IN silt clay loam0.500000
urea enriched soil0.500000
ph 7-90.500000
north china plain0.500000
wheat0.500000
ph>7, ph<80.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
ph>6, ph<70.500000
ph>80.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph&lt;4.50.500000
freshwater biome0.500000
mississippi river0.500000
ph>5, ph<60.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.444444
united states of america0.277778
rhizosphere0.277778
china0.244444
australia0.211111
body proper0.166667
whole body0.166667
cultivated environment0.166667
tick0.144444
citrus0.122222
depth 0-20cm0.100000
root0.088889
state of tennessee0.088889
agricultural feature0.088889
wheat0.088889
orchard0.077778
mexico0.066667
populus0.066667
tree0.066667
triticum aestivum0.066667
agave0.055556
desert0.055556
skin0.055556
leaf0.055556
state of florida0.055556
state of california0.055556
glycine max0.055556
north china plain0.055556
winter0.055556
guanajuato0.044444
vitis vinifera0.044444
merlot0.044444
grapevine0.044444
new york0.044444
river0.044444
agave salmiana0.033333
wild0.033333
homo sapiens0.033333
foot0.033333
woodland area0.033333
LOWER IN soil0.033333
control0.033333
depth 0-30cm0.033333
silt loam0.033333
heilongjiang province0.033333
zea mays0.033333
black soil0.033333
mollisol0.033333
kingdom of spain0.033333
LOWER IN root0.033333
haemaphysalis0.022222
haemaphysalis bancrofti0.022222
ixodes australiensis0.022222
ixodes fecialis0.022222
australian paralysis tick0.022222
ixodes holocyclus0.022222
ixodes ornithorhynchi0.022222
ixodes antechini0.022222
water0.022222
drinking water0.022222
scotland0.022222
santa catalina island0.022222
urocyon littoralis0.022222
santa catalina island fox0.022222
urocyon littoralis catalinae0.022222
ear canal0.022222
external acoustic meatus0.022222
leaf surface0.022222
topsoil0.022222
depth 0-10cm0.022222
forest ecosystem0.022222
heavy metal0.022222
oryza sativa0.022222
rice0.022222
without plants0.022222
difenoconazole0.022222
fungicide0.022222
ph 7-80.022222
tobacco field0.022222
limestone0.022222
ph<60.022222
npk fertilizer0.022222
state of idaho0.022222
biofilm0.022222
non-seleniferous0.022222
soybean0.022222
triticum aestivum l. cv., xiaoyan no. 220.022222
silty clay0.022222
depth 5cm0.022222
bulk soil0.022222
mississippi river0.022222
ixodes tasmani0.011111
bothriocroton concolor0.011111
haemaphysalis humerosa0.011111
site a0.011111
site d0.011111
root endosphere0.011111
snake0.011111
southern united states0.011111
fossorial snake0.011111
Exp. ID User ID Description Date Region Flag Sequences
621amnoncommon tick, haemaphysalis, haemaphysalis bancrofti, body proper, whole body, australia2020-05-07v1No1 / 3
621amnoncommon tick, ixodes tasmani, body proper, whole body, australia2020-05-07v1No1 / 3
621amnoncommon tick, ixodes australiensis, body proper, whole body, australia2020-05-07v1No1 / 5
621amnoncommon ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 5
621amnoncommon tick, bothriocroton concolor, body proper, whole body, australia2020-05-07v1No1 / 5
621amnoncommon body proper, whole body, australian paralysis tick, ixodes holocyclus, australia2020-05-07v1No1 / 6
621amnoncommon haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 7
621amnondominant tick, ixodes australiensis, body proper, whole body, australia2020-05-07v1No1 / 8
621amnondominant tick, haemaphysalis, haemaphysalis bancrofti, body proper, whole body, australia2020-05-07v1No1 / 8
621amnondominant ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 9
621amnondominant body proper, whole body, australian paralysis tick, ixodes holocyclus, australia2020-05-07v1No1 / 13
621amnoncommon ixodes ornithorhynchi, tick, body proper, whole body, australia2020-05-07v1No1 / 15
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 15
621amnoncommon tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 18
110amnoncommon water, drinking water, scotland, site a2017-04-08v4No1 / 21
621amnondominant ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 23
110amnoncommon water, drinking water, scotland, site d2017-04-08v4No1 / 35
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 86
536amnoncommon snake, skin, united states of america, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 100
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 104
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 165
101amnon high in soil compared to rhizosphere in vitis vinifera united states of america merlot grapevine new york 2017-04-03v4No1 / 248
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 299
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 373
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 483
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 491
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 493
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 542
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 558
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 563
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 592
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 627
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 657
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 707
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 720
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 742
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 764
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 769
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 829
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 889
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 907
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 909
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 914
462amnoncommon united states of america, state of tennessee, soil, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 937
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 949
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 949
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 962
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.5, root zone soil2017-04-15v4No1 / 967
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 979
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, depth 0-30cm, silt loam, cultivated environment2019-01-13v4No1 / 996
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1080
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1098
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1104
101amnoncommon merlot, vitis vinifera, grapevine, new york, united states of america, root2017-04-03v4No1 / 1105
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1180
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1278
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1281
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1339
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1370
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1413
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1419
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1427
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1458
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1620
665amnon high in inlet compared to outlet in late time points engineered wetland benthic biomat state of california water treatment pond microbial biomat biomat united states of america 2020-09-23v4No1 / 1629
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1642
462amnon high in depth 0-30cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1647
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1681
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, rhizosphere2017-04-03v4No1 / 1979
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2132
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2159
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2161
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2222
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2340
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2424
101amnoncommon vitis vinifera, united states of america, merlot, grapevine, new york, soil2017-04-03v4No1 / 2536
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2593
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2645
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2772
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2855
166amnoncommon in river sediment (5cm) without mussels (common freshwater biome, river, united states of america, sediment, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2876
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2932
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3507
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in river united states of america mississippi river fresh water aquatic biome )2017-04-05v4No1 / 3558
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5885
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7627
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7953

Problems / suggestions? Please email info AT dbbact DOT org