Search result for sequence:
GACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAAAGGCCCTTTCGGGGGTACTCGAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCACTTCGGGATAAGCTTGGGAAACTGGGTCTAATACCGGATAGGA
common ontology terms
term enrichment score
TermScore
soil0.479705
rhizosphere0.246353
forest ecosystem0.222222
depth 0-20cm0.190476
woodland area0.185430
topsoil0.177215
wheat0.150000
leaf0.147783
china0.144669
citrus0.124444
root0.121212
agricultural feature0.120690
depth 0-10cm0.118721
canada0.111111
triticum aestivum0.107143
permafrost0.105263
north china plain0.105263
zhejiang province0.100000
state of idaho0.100000
plant0.081967
cultivated environment0.081967
skin0.075000
tundra0.072727
southern united states0.072727
ivy0.072727
hedera ibernica0.072727
brassicaceae0.072727
boechera stricta0.072727
quzhou county0.072727
days 1800.072727
mature barley plants0.072727
tick0.070175
snake0.070175
ph 4-50.070175
hordeum vulgare0.070175
kingdom of norway0.067797
depth 15cm0.067797
australia0.066890
whole body0.061538
belgium0.061538
winter0.060606
brazil0.060606
body proper0.057971
zea mays0.056338
united states of america0.055851
southern temperate forest0.055556
temperate broadleaf and mixed forest biome0.055556
subpolar coniferous forest biome0.055556
boreal forest0.055556
nenets autonomous okrug0.055556
minas gerais state0.055556
campos rupestres0.055556
myrtillocactus geometrizans0.055556
opuntia robusta0.055556
arachis hypogaea0.055556
peanut0.055556
svalbard archipelago0.055556
bon portage island0.055556
burrow0.055556
ph<50.055556
orchard0.055556
glycine max0.055556
bulk soil0.055556
ph 60.055556
solanum lycopersicum0.054795
cactus0.054054
semi-arid0.054054
ph 50.052632
LOWER IN rhizosphere0.051724
russia0.051282
mexico0.050000
state of florida0.049383
wild0.045977
sphagnum bog0.038095
haemaphysalis humerosa0.037736
santa catalina island0.037736
urocyon littoralis0.037736
santa catalina island fox0.037736
urocyon littoralis catalinae0.037736
ft. pierce, fl0.037736
vellozia epidendroides0.037736
moor0.037736
oceanodroma leucorhoa0.037736
seabird0.037736
red soil0.037736
cambisol0.037736
LOWER IN ph&gt;50.037736
ph>6, ph<6.50.037736
populus0.037736
tomato0.037736
peatland0.037383
depth 5cm0.037383
paddy field soil0.037037
province of quebec0.037037
soybean0.037037
ear canal0.036364
external acoustic meatus0.036364
state of tennessee0.035714
tree0.035714
sweden0.035398
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
sphagnum bog0.666667
citrus0.666667
zea mays0.666667
triticum aestivum0.600000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
ixodes fecialis0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
haemaphysalis humerosa0.500000
ixodes australiensis0.500000
alpine bog0.500000
plant surface0.500000
tundra0.500000
permafrost0.500000
nenets autonomous okrug0.500000
crotalus horridus0.500000
southern united states0.500000
timber rattlesnake0.500000
santa catalina island0.500000
urocyon littoralis0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
LOWER IN lip0.500000
LOWER IN labial commissure0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
ivy0.500000
hedera ibernica0.500000
LOWER IN scrubland0.500000
LOWER IN moor0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
ft. pierce, fl0.500000
immokalee, fl0.500000
lapland0.500000
site 20.500000
LOWER IN site 10.500000
agkistrodon contortrix0.500000
copperhead snake0.500000
potting mix0.500000
LOWER IN amended with biochar0.500000
ph<40.500000
LOWER IN ph&gt;40.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
ph<30.500000
LOWER IN ph&gt;30.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
LOWER IN perianal skin0.500000
mature soil0.500000
arachis hypogaea0.500000
peanut0.500000
svalbard archipelago0.500000
depth 0-20cm0.500000
permafrost active layer0.500000
pinus siberica0.500000
pine forest0.500000
siberia0.500000
vellozia epidendroides0.500000
permafrost transition layer0.500000
LOWER IN depth 20-30cm0.500000
cannabis sativa0.500000
moor0.500000
LOWER IN dense settlement biome0.500000
mediterranean forest biome0.500000
elevation 500-600m0.500000
lushan mountain0.500000
forested area0.500000
terrestrial snake0.500000
LOWER IN aquatic snake0.500000
montane forest0.500000
savanna0.500000
scrubland0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
red soil0.500000
cambisol0.500000
ph<50.500000
LOWER IN ph&gt;50.500000
orchard0.500000
reunion island0.500000
copper0.500000
brassicaceae0.500000
boechera stricta0.500000
ph>6, ph<6.50.500000
populus0.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
maryland county0.500000
LOWER IN solanum lycopersicum0.500000
quincy, fl0.500000
agricultural feature0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.637255
china0.274510
rhizosphere0.186275
united states of america0.176471
forest ecosystem0.166667
topsoil0.137255
woodland area0.137255
depth 0-10cm0.127451
depth 0-20cm0.117647
leaf0.098039
wheat0.088235
root0.078431
citrus0.068627
agricultural feature0.068627
permafrost0.058824
skin0.058824
canada0.058824
triticum aestivum0.058824
zhejiang province0.058824
state of idaho0.058824
north china plain0.058824
winter0.058824
australia0.049020
plant0.049020
cultivated environment0.049020
tick0.039216
body proper0.039216
whole body0.039216
tundra0.039216
snake0.039216
southern united states0.039216
belgium0.039216
ivy0.039216
hedera ibernica0.039216
brazil0.039216
state of florida0.039216
kingdom of norway0.039216
brassicaceae0.039216
boechera stricta0.039216
quzhou county0.039216
depth 15cm0.039216
ph 4-50.039216
hordeum vulgare0.039216
days 1800.039216
mature barley plants0.039216
southern temperate forest0.029412
temperate broadleaf and mixed forest biome0.029412
subpolar coniferous forest biome0.029412
boreal forest0.029412
russia0.029412
nenets autonomous okrug0.029412
wild0.029412
minas gerais state0.029412
campos rupestres0.029412
solanum lycopersicum0.029412
mexico0.029412
myrtillocactus geometrizans0.029412
opuntia robusta0.029412
cactus0.029412
semi-arid0.029412
ph 50.029412
arachis hypogaea0.029412
peanut0.029412
svalbard archipelago0.029412
LOWER IN rhizosphere0.029412
bon portage island0.029412
burrow0.029412
zea mays0.029412
ph<50.029412
orchard0.029412
glycine max0.029412
bulk soil0.029412
ph 60.029412
haemaphysalis humerosa0.019608
peatland0.019608
sphagnum bog0.019608
santa catalina island0.019608
urocyon littoralis0.019608
santa catalina island fox0.019608
urocyon littoralis catalinae0.019608
ear canal0.019608
external acoustic meatus0.019608
sweden0.019608
stem0.019608
ft. pierce, fl0.019608
vellozia epidendroides0.019608
farm0.019608
moor0.019608
bird0.019608
oceanodroma leucorhoa0.019608
seabird0.019608
hunan province0.019608
red soil0.019608
cambisol0.019608
LOWER IN ph&gt;50.019608
control0.019608
research facility0.019608
paddy field soil0.019608
ph>6, ph<6.50.019608
state of tennessee0.019608
Exp. ID User ID Description Date Region Flag Sequences
357amnondominant soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 1
357amnondominant soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 2
621amnoncommon ixodes fecialis, tick, body proper, whole body, australia2020-05-07v1No1 / 5
357amnondominant soil, topsoil, depth 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 7
621amnoncommon haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 7
621amnondominant tick, ixodes australiensis, body proper, whole body, australia2020-05-07v1No1 / 8
621amnondominant haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 8
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 64
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 80
536amnoncommon crotalus horridus, snake, skin, united states of america, southern united states, timber rattlesnake2019-07-28v4No1 / 100
582amnon high in ear canal external acoustic meatus compared to lip labial commissure in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 104
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 109
536amnoncommon snake, skin, united states of america, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 109
128amnonhigher in ivy leaves from forest compared to moor ( high in forest ecosystem compared to scrubland moor in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 122
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 122
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 125
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 159
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 212
426amnon high in site 2 compared to site 1 in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 227
536amnoncommon snake, skin, united states of america, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 235
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 251
357amnon high in ph<4 compared to ph>4 in soil topsoil depth 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 281
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 290
357amnon high in ph<3 compared to ph>3 in soil topsoil depth 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 296
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 337
582amnon high in ear canal external acoustic meatus compared to perianal skin rectum in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 373
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 376
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 396
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 0-20cm, permafrost active layer2018-07-15v4No1 / 404
147amnoncommon tundra, soil, pinus siberica, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 415
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 430
357amnoncommon soil, topsoil, depth 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 473
347amnon high in depth 0-20cm permafrost transition layer compared to depth 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 476
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 482
357amnoncommon soil, topsoil, depth 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 498
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 509
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in belgium ivy hedera ibernica leaf )2017-04-14v4No1 / 524
357amnoncommon soil, topsoil, depth 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 537
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 547
357amnoncommon soil, topsoil, depth 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 563
667amnoncommon ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, depth 0-20cm, topsoil, soil2020-09-25v4No1 / 575
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 589
357amnoncommon soil, topsoil, depth 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 591
357amnoncommon soil, topsoil, depth 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 613
128amnoncommon belgium, ivy, hedera ibernica, leaf, moor, scrubland2017-04-14v4No1 / 622
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 637
128amnoncommon belgium, ivy, hedera ibernica, leaf, forest ecosystem2017-04-14v4No1 / 692
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 705
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 707
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 720
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 739
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 822
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 823
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 829
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 842
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.52017-04-15v4No1 / 883
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 889
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 914
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 949
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 949
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 962
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, ph>6, ph<6.5, root zone soil2017-04-15v4No1 / 967
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 969
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1022
347amnon high in depth 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1079
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1089
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1090
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1102
357amnon high in ph<5 compared to ph>5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1103
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1109
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1134
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1135
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1143
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1191
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1208
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1246
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1333
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1339
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1388
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1398
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1419
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1455
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1458
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1514
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1620
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1885
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1976
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2159
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2222
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2340
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2424
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2593
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2645
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2714
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2855
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3507
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3655
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4261
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4629
271amnon high in soil compared to rhizosphere glycine max soybean in depth 0-20cm china 2018-01-09v4No1 / 4852
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5885
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7953

Problems / suggestions? Please email info AT dbbact DOT org