dbBact sequence annotation

Search result for sequence:

GACGCTAAAGACGAGTGTTATTCATCTTAAATAGGTTTAAAGGGTACCTAGACGGAAAAAAATATTTTCTAGAGTTTAAATAAAAGAAGGTAGTACTTAGAGTGTAGAGATATAATTTTTTTATACCTAAAGGACGGATAAAGGCGAAAG

Taxonomy: d__Bacteria

species	# matches	SILVA IDs

term enrichment score

Term	Score
minas gerais state	0.666667
campos rupestres	0.666667
barbacenia macrantha	0.666667
root endosphere	0.333333
root	0.117647
brazil	0.100000
rhizosphere	0.040816

Fraction of dbbact annotations with this term covered by the query

Term	Score
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
root endosphere	0.250000
root	0.066667
brazil	0.052632
rhizosphere	0.021277

Fraction of annotations for the query sequences containing the term

Term	Score
minas gerais state	1.000000
campos rupestres	1.000000
brazil	1.000000
barbacenia macrantha	1.000000
root endosphere	0.500000
root	0.500000
rhizosphere	0.500000

Exp. ID	User ID	Description	Date	Region	Flag	Sequences
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root	2019-08-17	v4	No	1 / 575
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere	2019-08-17	v4	No	1 / 651