Search result for sequence:
GACGGAGGGTGCAAGCGTTGTTCGGATTGACTGGGCGTAAAGGGCGTGTAGGCGGTTGGTTAAGTCGGGTGTGAAAGCCCGGGGCTCAGCTCCGGAAGTGCGCCCGAAACTGGCCAGCTGGAGCGCGGTAGAGGAGGGTGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
minas gerais state0.555556
campos rupestres0.555556
barbacenia macrantha0.333333
temperate grassland biome0.200000
flooded grassland biome0.200000
central park0.200000
ph<5.50.200000
LOWER IN ph&gt;5.50.200000
LOWER IN soilwater0.200000
ph 3.50.200000
vellozia epidendroides0.200000
depth 20cm0.181818
fen0.181818
park0.181818
province of quebec0.181818
peat soil0.166667
urban biome0.166667
root endosphere0.166667
new york city0.133333
rock0.125000
brazil0.097087
root0.086957
soil0.073394
united kingdom0.062500
canada0.052632
rhizosphere0.039216
ph0.032258
LOWER IN water0.031746
Fraction of dbbact annotations with this term covered by the query
TermScore
temperate grassland biome0.500000
flooded grassland biome0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
LOWER IN soilwater0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
depth 20cm0.333333
fen0.333333
park0.333333
province of quebec0.333333
peat soil0.250000
urban biome0.250000
root endosphere0.250000
new york city0.142857
rock0.125000
root0.066667
brazil0.052632
united kingdom0.041667
soil0.039604
canada0.033333
rhizosphere0.021277
ph0.018519
LOWER IN water0.018182
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state0.625000
campos rupestres0.625000
brazil0.625000
soil0.500000
rhizosphere0.250000
barbacenia macrantha0.250000
depth 20cm0.125000
temperate grassland biome0.125000
fen0.125000
peat soil0.125000
flooded grassland biome0.125000
united kingdom0.125000
urban biome0.125000
park0.125000
new york city0.125000
central park0.125000
ph0.125000
ph<5.50.125000
LOWER IN ph&gt;5.50.125000
LOWER IN soilwater0.125000
canada0.125000
province of quebec0.125000
LOWER IN water0.125000
ph 3.50.125000
vellozia epidendroides0.125000
rock0.125000
root endosphere0.125000
root0.125000

Problems / suggestions? Please email info AT dbbact DOT org