Search result for sequence:
GACGGAGGTGGCGAGCGTTGTTCGGAATTACTGGGCTTAAAGGGCGCGTAGGCGGTATGTTAAGTCGAAGGTGGAAGGCATGGGCTCAACCCATGGACAGCCTTCGAAACTGGCGTACTTGAGTCGTGCAGGGGATGGCGGAATTCCAGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mudflat0.500000
dongzhaigang national nature reserve0.500000
mangrove biome0.500000
mangrove swamp0.500000
leizhou nature reserve0.500000
futian national nature reserve0.500000
ximendao national marine reserve0.500000
kandelia candel0.500000
hainan autonomous prefecture0.333333
spartina alterniflora0.333333
guangdong province0.333333
mangrove0.333333
depth 0-20cm0.200000
zhejiang province0.200000
marine sediment0.071429
rhizosphere0.037037
china0.020833
soil0.018519
Fraction of annotations for the query sequences containing the term
TermScore
mangrove swamp1.000000
china1.000000
mangrove biome0.857143
depth 0-20cm0.857143
marine sediment0.857143
soil0.857143
zhejiang province0.571429
spartina alterniflora0.428571
mudflat0.285714
futian national nature reserve0.285714
ximendao national marine reserve0.285714
dongzhaigang national nature reserve0.142857
hainan autonomous prefecture0.142857
leizhou nature reserve0.142857
guangdong province0.142857
rhizosphere0.142857
kandelia candel0.142857
mangrove0.142857

Problems / suggestions? Please email info AT dbbact DOT org