Search result for sequence:
GACGGGGGGGGCAAGTGTTCTTCGGAATGACTAGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG
common ontology terms
term enrichment score
TermScore
oryza sativa0.249135
rhizosphere0.163314
jilin province0.150376
black soil0.139860
rice0.137405
china0.128138
soil0.127824
ph 70.122699
israel0.120690
zoological garden0.104575
paddy field soil0.104478
gallus gallus0.098074
state of california0.096654
cocoa mass0.096000
theobroma cacao0.096000
state of tabasco0.096000
food product type0.096000
skin0.094017
canada0.089686
cultivated environment0.082840
chicken0.082759
neve yaar0.081301
cigar0.081301
tobacco0.081301
captive0.081159
nicotiana tabacum0.078125
mexico0.077419
ph 6-70.076628
ileum0.075188
italy0.069124
rumen0.068337
research facility0.066377
vigna radiata0.066116
mung bean sprouts0.066116
african lion safari0.066116
wild0.064865
ruminal fluid0.064000
cameroon0.064000
heilongjiang province0.064000
monkey0.061350
depth (soil) 0-20cm0.058968
glycine soja0.050420
producer c10.050420
producer c20.050420
cobb broiler chicken0.050420
age 35 days0.049180
water0.048860
irrigated0.048000
root0.046243
gorilla gorilla0.045802
glycine max0.044776
agricultural field0.043796
caecum0.043716
farm0.040268
depth (soil) 0-10cm0.039474
oryza rufipogon0.034188
heteromeles arbutifolia0.034188
ceanothus jepsonii0.034188
hebei province0.034188
luancheng county0.034188
fluvo-aquic soil0.034188
cocoa strain criollo0.034188
cocoa strain forasterio0.034188
fruit0.034188
intestinal contents0.034188
nile tilapia0.034188
toronto zoo0.034188
medicago sativa0.034188
alfalfa sprouts0.034188
cheyenne menthol box cigar0.034188
cheyenne full flavor cigar0.034188
lower saxony0.034188
sandy soil0.034188
acidosis0.034188
subacute rumen acidosis0.034188
dairy goat0.034188
grass growth diet0.034188
alpine meadow0.034188
nature reserve0.034188
central chimpanzee0.034188
LOWER IN europe0.034188
treated wastewater0.034188
mangrove biome0.034188
madrid0.033613
cucumis sativus0.033613
oreochromis niloticus0.033613
shanxi province0.033613
yak0.033613
european rabbit0.033613
drought environment0.033613
pan troglodytes troglodytes0.033613
digesta0.033333
hunan province0.033333
cucumber0.033058
province of ontario0.033058
epidermis0.033058
drinking water0.033058
maize field0.033058
bos grunniens0.033058
kenya0.033058
Fraction of dbbact annotations with this term covered by the query
TermScore
oryza sativa0.571429
rice0.500000
jilin province0.500000
glycine soja0.500000
oryza rufipogon0.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
hebei province0.500000
luancheng county0.500000
fluvo-aquic soil0.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
cocoa strain criollo0.500000
cocoa strain forasterio0.500000
food product type0.500000
vigna radiata0.500000
producer c10.500000
mung bean sprouts0.500000
LOWER IN bronchitis0.500000
LOWER IN infectious bronchitis virus0.500000
skin of body0.500000
fruit0.500000
neve yaar0.500000
producer c20.500000
time 5 days0.500000
fermented cocoa mass0.500000
subsurface0.500000
depth 20-100cm0.500000
LOWER IN depth 0-20cm0.500000
intestinal contents0.500000
age 60 weeks0.500000
upper eyelid0.500000
cobb broiler chicken0.500000
aphis gossypii0.500000
cotton aphid0.500000
palmar part of manus0.500000
palm of hand0.500000
omsk0.500000
peking duck0.500000
hexaprotodon liberiensis0.500000
pygmy hippopotamus0.500000
nile tilapia0.500000
eidolon helvum0.500000
toronto zoo0.500000
fruit bat0.500000
mucosa of stomach0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
medicago sativa0.500000
alfalfa sprouts0.500000
pteropus giganteus0.500000
african lion safari0.500000
indian flying fox0.500000
commune of paris0.500000
cigar0.500000
tobacco0.500000
cheyenne menthol box cigar0.500000
time 00.500000
LOWER IN time 5 days0.500000
LOWER IN fermented cocoa mass0.500000
swisher sweets original cigar0.500000
cheyenne full flavor cigar0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
alpine pasture0.500000
hippopotamus amphibius0.500000
swisher sweets sweet cherry cigar0.500000
bangladesh0.500000
zone 10.500000
LOWER IN zone 2,30.500000
mine tailing0.500000
guangxi zhuang autonomous region0.500000
alkaline mine tailing0.500000
lower saxony0.500000
sandy soil0.500000
ammotragus lervia0.500000
barbary sheep0.500000
acidosis0.500000
subacute rumen acidosis0.500000
dairy goat0.500000
grass growth diet0.500000
LOWER IN green stage diet0.500000
alpine meadow0.500000
nature reserve0.500000
central chimpanzee0.500000
LOWER IN europe0.500000
LOWER IN pan troglodytes verus0.500000
LOWER IN eastern chimpanzee0.500000
LOWER IN withered grass diet0.500000
clay soil0.500000
hypersaline water0.500000
depth (water) 4-9m0.500000
monimolimnion0.500000
LOWER IN depth (water) 0-3m0.500000
LOWER IN mixolimnion0.500000
LOWER IN depth (water) 20-100cm0.500000
LOWER IN depth (water) 1-5m0.500000
romania0.500000
Fraction of annotations for the query sequences containing the term
TermScore
china0.283186
soil0.256637
rhizosphere0.203540
oryza sativa0.159292
united states of america0.141593
israel0.123894
state of california0.115044
research facility0.106195
skin0.097345
feces0.097345
ph 70.088496
black soil0.088496
jilin province0.088496
canada0.088496
rice0.079646
zoological garden0.070796
gallus gallus0.061947
captive0.061947
paddy field soil0.061947
cultivated environment0.061947
mexico0.053097
cocoa mass0.053097
theobroma cacao0.053097
state of tabasco0.053097
food product type0.053097
chicken0.053097
homo sapiens0.053097
adult0.053097
wild0.053097
ph 6-70.044248
neve yaar0.044248
italy0.044248
ileum0.044248
water0.044248
nicotiana tabacum0.044248
cigar0.044248
tobacco0.044248
rumen0.044248
monkey0.044248
root0.035398
vigna radiata0.035398
mung bean sprouts0.035398
caecum0.035398
african lion safari0.035398
LOWER IN control0.035398
ruminal fluid0.035398
cameroon0.035398
depth (soil) 0-20cm0.035398
heilongjiang province0.035398
glycine max0.026549
glycine soja0.026549
producer c10.026549
producer c20.026549
male0.026549
cobb broiler chicken0.026549
age 35 days0.026549
farm0.026549
gorilla gorilla0.026549
depth (soil) 0-10cm0.026549
irrigated0.026549
agricultural field0.026549
city0.017699
air0.017699
kingdom of spain0.017699
madrid0.017699
oryza rufipogon0.017699
heteromeles arbutifolia0.017699
ceanothus jepsonii0.017699
triticum aestivum0.017699
hebei province0.017699
luancheng county0.017699
ph 7.60.017699
fluvo-aquic soil0.017699
cocoa strain criollo0.017699
cocoa strain forasterio0.017699
control0.017699
cecal content0.017699
surface0.017699
fruit0.017699
cucumis sativus0.017699
cucumber0.017699
sweden0.017699
digesta0.017699
intestinal contents0.017699
female organism0.017699
province of ontario0.017699
epidermis0.017699
LOWER IN caecum0.017699
LOWER IN colon0.017699
oreochromis niloticus0.017699
state of texas0.017699
nile tilapia0.017699
hunan province0.017699
toronto zoo0.017699
drinking water0.017699
medicago sativa0.017699
alfalfa sprouts0.017699
cheyenne menthol box cigar0.017699
cheyenne full flavor cigar0.017699
germany0.017699
Exp. ID User ID Description Date Region Flag Sequences
662amnoncucmber and melon mitochondria (other mitochondrion)2020-09-21v3No1 / 1
171amnondominant united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 2
171amnondominant united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 2
682amnondominant city, air, kingdom of spain, madrid2028-03-04v3No1 / 4
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild rice (Oryza rufipogon) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 7
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 9
755sheryodominant in domesticated rice (Oryza stavia) rhizosphere (dominant soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 11
750sheryoDominant in soil of wheat field in China (dominant soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 12
789amnondominant in traditionally harvested cocoa pulp before fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain criollo)2021-06-01v3No1 / 13
789amnondominant in traditionally harvested cocoa pulp before fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain forasterio)2021-06-01v3No1 / 13
587amnondominant israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 15
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 16
623amnoncommon homo sapiens, united states of america, skin, adult, commonwealth of pennsylvania, skin of body, umbilicus2020-05-10v3No1 / 18
662amnondominant in cucumber surface (dominant surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 19
587amnondominant israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 23
666amnoncommon feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 29
789amnoncommon in traditionally harvested cocoa pulp after fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 35
587amnoncommon israel, food product type, vigna radiata, producer c1, mung bean sprouts2020-02-10v3No1 / 42
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
744amnon high in ileum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 47
662amnoncommon in cucumber surface (common surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 49
771amnoncommon body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 54
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
790amnoncommon farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 61
587amnoncommon israel, food product type, vigna radiata, producer c2, mung bean sprouts2020-02-10v3No1 / 67
682amnoncommon city, air, kingdom of spain, madrid2028-03-04v3No1 / 67
789amnoncommon in traditionally harvested cocoa pulp before fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain criollo)2021-06-01v3No1 / 67
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
373amnonhigher in soil of mature plants compared to seedlings ( high in late timepoints compared to seedling early timepoints in rice field soil rhizosphere oryza sativa hunan province rice china )2018-09-08v4No1 / 81
789amnoncommon in traditionally harvested cocoa pulp before fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain forasterio)2021-06-01v3No1 / 82
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
565amnoncommon zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 83
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, stomach, biopsy, south korea, mucosa of stomach)2019-12-16v3No1 / 85
662amnoncommon water, drinking water, tap water, israel2020-09-20v3No1 / 89
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c12020-02-10v3No1 / 106
565amnoncommon zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 109
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne menthol box cigar)2021-03-28v3No1 / 115
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
789amnonhigh in unfemented compared to fermented cocoa mass ( high in time 0 compared to time 5 days fermented cocoa mass in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
565amnoncommon zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 122
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets original cigar)2021-03-28v3No1 / 127
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, cheyenne full flavor cigar)2021-03-28v3No1 / 128
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
758amnoncommon in cigar tobacco (common nicotiana tabacum, cigar, tobacco, swisher sweets sweet cherry cigar)2021-03-28v3No1 / 154
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 200
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 207
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 210
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 213
587amnoncommon israel, food product type, medicago sativa, alfalfa sprouts, producer c22020-02-10v3No1 / 215
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
561amnon high in summer grass growth diet compared to green stage diet spring in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 256
639amnoncommon feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 280
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 282
729amnon high in wild pan troglodytes troglodytes cameroon central chimpanzee compared to zoological garden captive europe pan troglodytes verus eastern chimpanzee in feces monkey 2021-01-05v3No1 / 288
561amnon high in summer grass growth diet compared to winter withered grass diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 294
565amnoncommon zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 310
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
577amnon high in high salinity hypersaline water depth (water) 4-9m monimolimnion compared to low salinity depth (water) 0-3m mixolimnion depth (water) 20-100cm depth (water) 1-5m in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
758amnon high in cheyenne full flavor cigar cheyenne menthol box cigar compared to swisher sweets original cigar swisher sweets sweet cherry cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 452
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
662amnoncommon water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 473
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in feces nature reserve adult australia wild 2020-08-21v3No1 / 480
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, loam, neve yaar, loam soil2020-09-21v3No1 / 489
798amnoncommon orchard, hay, italy, plant litter, apennine mountains, prunus armeniaca, apricot, litter bag, depth (soil) 0-20cm, depth (soil) 10 cm2021-06-13v3No1 / 508
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 530
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
662amnon high in wastewater treatment plant treated wastewater compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
662amnoncommon soil, israel, depth (soil) 0-10cm, irrigated, agricultural field, neve yaar, loamy sand soil2020-09-22v3No1 / 609
793amnoncommon rhizosphere, mangrove biome, kenya, mangrove, ceriops tagal, depth (soil) 0-20cm2021-06-08v3No1 / 662
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
793amnoncommon rhizosphere, mangrove biome, kenya, mangrove, rhizophora mucronata, depth (soil) 0-20cm2021-06-08v3No1 / 900
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, china, saccharum, sugarcane, ph 6.7, depth (soil) 0-20cm)2020-04-27v3No1 / 1277
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399

Problems / suggestions? Please email info AT dbbact DOT org