Search result for sequence:
GACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG
common ontology terms
term enrichment score
TermScore
citrus0.322388
leaf0.307278
plant0.191083
state of florida0.187207
agave0.180645
minas gerais state0.169935
campos rupestres0.169935
root0.156250
cultivated environment0.153005
rhizosphere0.145946
leaf endosphere0.140845
state of rhode island0.136054
guanajuato0.136054
soil0.131378
brazil0.124444
desert0.124444
orchard0.124138
austria0.116883
mexico0.112994
greenhouse0.111888
costa rica0.099291
barbacenia macrantha0.099291
beetle0.088235
leaf surface0.088235
foodon product type0.086420
vellozia epidendroides0.086331
flower0.084507
germany0.084388
root endosphere0.074349
herbivorous beetle0.072993
agave tequiliana0.072993
poland0.070423
whole body0.068027
united states of america0.066813
homo sapiens0.065862
skin0.063191
vero beach, fl0.059259
immokalee, fl0.059259
gainesville, fl0.059259
quincy, fl0.059259
nida basin0.059259
agave deserti0.059259
other plants0.059259
nectar0.057554
digestive system0.051414
hunter gatherer0.045802
arm0.045627
peatland0.045455
canada0.045113
LOWER IN other plants0.045113
state of california0.045045
province of quebec0.044118
pair of nares0.043796
food (fermented)0.043165
stem0.041379
olea europaea0.030769
sphagnum bog0.030769
LOWER IN nasopharynx0.030769
venezuela0.030769
amerindian0.030769
ft. pierce, fl0.030534
onion0.030534
garlic0.030534
reunion island0.030534
ant0.030534
centris atripes0.030534
ruellia terminalis0.030534
vaccinium macrocarpon0.030534
american cranberry0.030534
crioceris duodecimpunctata0.030534
stachytarpheta frantzii0.030534
purple porterweed0.030534
scallion0.030534
dracaena fragrans0.030534
adave salmiana0.030534
stem endosphere0.030534
agave salmiana0.030534
LOWER IN soilwater0.030534
prunella vulgaris0.030534
woundwort0.030534
geranium pratense0.030534
meadow geranium0.030534
chuquisaca department0.030534
forearm0.030534
veronica chamaedrys0.030534
germander speedwell0.030534
allium cepa0.030075
commonwealth of massachusetts0.030075
age 5-13 years0.030075
belgium0.029851
bolivia0.029630
tree0.029197
LOWER IN soil0.028986
topsoil0.028777
depth 0-10cm0.028369
woodland area0.028369
rural community0.028369
australia0.028169
forest ecosystem0.027586
LOWER IN water0.026846
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
olea europaea0.666667
citrus0.666667
sphagnum bog0.666667
beetle0.666667
leaf endosphere0.666667
leaf surface0.666667
root endosphere0.666667
LOWER IN nasopharynx0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
peatland0.600000
plant chloroplast0.500000
olive tree0.500000
vero beach, fl0.500000
immokalee, fl0.500000
gainesville, fl0.500000
ft. pierce, fl0.500000
quincy, fl0.500000
state of rhode island0.500000
onion0.500000
garlic0.500000
orchard0.500000
reunion island0.500000
plant0.500000
alpine bog0.500000
plant surface0.500000
ant0.500000
costa rica0.500000
pseudomyrmex cubaensis0.500000
centris atripes0.500000
ruellia terminalis0.500000
vaccinium macrocarpon0.500000
american cranberry0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
scallion0.500000
greenhouse0.500000
dracaena fragrans0.500000
epipremnum aureum0.500000
agave0.500000
adave salmiana0.500000
guanajuato0.500000
crioceris quatuordecimpunctata0.500000
stem endosphere0.500000
agave tequiliana0.500000
vellozia epidendroides0.500000
miso food product0.500000
pseudomyrmex simplex0.500000
austin0.500000
LOWER IN australia0.500000
LOWER IN malaysia0.500000
LOWER IN seoul0.500000
agave deserti0.500000
aloe arborescens0.500000
aloe0.500000
radish0.500000
anoplophora glabripennis0.500000
trigona hyalinata0.500000
kimchi0.500000
LOWER IN days 1-90.500000
beaucarnea recurvata0.500000
centricnemus leucogrammus0.500000
agave salmiana0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
malvaviscus penduliflorus0.500000
LOWER IN hedge bedstraw0.500000
LOWER IN galium mollugo0.500000
other plants0.500000
howea forsteriana0.500000
anterior naris0.500000
age 130.500000
alouatta pigra0.500000
howler monkey0.500000
central america0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
lapland0.500000
canada0.500000
mangrove0.500000
avicennia germinans0.500000
rhizophora mangle0.500000
chlorophytum comosum0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph<30.500000
LOWER IN ph>30.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
leaf0.299213
citrus0.212598
rhizosphere0.212598
state of florida0.157480
united states of america0.149606
soil0.125984
plant0.118110
root0.118110
cultivated environment0.110236
brazil0.110236
agave0.110236
desert0.110236
minas gerais state0.102362
campos rupestres0.102362
state of rhode island0.078740
leaf endosphere0.078740
guanajuato0.078740
mexico0.078740
homo sapiens0.078740
germany0.078740
orchard0.070866
austria0.070866
greenhouse0.062992
foodon product type0.055118
costa rica0.055118
barbacenia macrantha0.055118
flower0.047244
beetle0.047244
leaf surface0.047244
vellozia epidendroides0.047244
digestive system0.039370
poland0.039370
whole body0.039370
herbivorous beetle0.039370
agave tequiliana0.039370
root endosphere0.039370
state of california0.039370
skin0.039370
vero beach, fl0.031496
immokalee, fl0.031496
gainesville, fl0.031496
quincy, fl0.031496
nectar0.031496
nida basin0.031496
agave deserti0.031496
feces0.031496
other plants0.031496
peatland0.023622
stem0.023622
food (fermented)0.023622
pair of nares0.023622
arm0.023622
hunter gatherer0.023622
canada0.023622
province of quebec0.023622
LOWER IN other plants0.023622
olea europaea0.015748
ft. pierce, fl0.015748
allium cepa0.015748
onion0.015748
garlic0.015748
reunion island0.015748
sphagnum bog0.015748
ant0.015748
larval stage0.015748
centris atripes0.015748
ruellia terminalis0.015748
vaccinium macrocarpon0.015748
american cranberry0.015748
commonwealth of massachusetts0.015748
crioceris duodecimpunctata0.015748
stachytarpheta frantzii0.015748
purple porterweed0.015748
scallion0.015748
dracaena fragrans0.015748
adave salmiana0.015748
stem endosphere0.015748
china0.015748
belgium0.015748
adult0.015748
LOWER IN nasopharynx0.015748
agave salmiana0.015748
venezuela0.015748
amerindian0.015748
tree0.015748
topsoil0.015748
depth 0-10cm0.015748
woodland area0.015748
forest ecosystem0.015748
LOWER IN soil0.015748
LOWER IN soilwater0.015748
LOWER IN water0.015748
prunella vulgaris0.015748
woundwort0.015748
geranium pratense0.015748
meadow geranium0.015748
australia0.015748
child0.015748
age 5-13 years0.015748
bolivia0.015748
Exp. ID User ID Description Date Region Flag Sequences
295amnonolive tree chloroplast (other plant chloroplast, chloroplast, olive tree, olea europaea)2018-02-10v4No1 / 1
98amnonhighfreq citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 2
98amnonhighfreq citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 3
98amnonhighfreq citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 3
98amnonhighfreq citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 4
98amnonhighfreq citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 4
311amnonhighfreq united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 4
311amnonhighfreq united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 6
415amnonhighfreq rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 6
130amnonhighfreq peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 7
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
98amnonhighfreq citrus, rhizosphere, quincy, fl, state of florida, root2017-04-01v4No1 / 8
98amnonhighfreq citrus, rhizosphere, immokalee, fl, state of florida, root2017-04-01v4No1 / 9
98amnonhighfreq citrus, rhizosphere, gainesville, fl, state of florida, root2017-04-01v4No1 / 9
59amnonhighfreq centris atripes, digestive system2017-02-03v4No1 / 11
501amnoncommon costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 11
544amnonhighfreq flower, vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts2019-08-04v4No1 / 11
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
548amnonhighfreq minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 12
98amnonhighfreq citrus, rhizosphere, vero beach, fl, state of florida, root2017-04-01v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
311amnonhighfreq united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, olea europaea2018-08-21v4No1 / 14
360amnonhighfreq agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
548amnonhighfreq minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 15
360amnonhighfreq agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 16
548amnonhigh freq. in leaf surface of barbacenia macrantha (highfreq minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 16
360amnonhighfreq agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 17
548amnonhighfreq minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 17
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
311amnoncommon united states of america, state of rhode island, miso food product, food (fermented)2018-04-09v4No1 / 22
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
59amnon high in austin united states of america compared to australia malaysia seoul china in apis mellifera digestive system 2017-02-02v4No1 / 25
544amnoncommon flower, vaccinium macrocarpon, american cranberry, united states of america, commonwealth of massachusetts2019-08-04v4No1 / 25
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 26
360amnonhighfreq agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 30
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
361amnoncommon leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 34
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
360amnoncommon agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 39
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
59amnoncommon trigona hyalinata, digestive system2017-02-02v4No1 / 43
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 52
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
309amnon high in other plants compared to hedge bedstraw galium mollugo in rhizosphere germany 2018-04-05v4No1 / 110
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 164
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
282amnoncommon soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
357amnon high in ph<3 compared to ph>3 in soil topsoil depth 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 297
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v4No1 / 355
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
309amnon high in other plants compared to festuca rubra red fescue grass in rhizosphere germany 2018-04-05v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v4No1 / 617
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1171
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715

Problems / suggestions? Please email info AT dbbact DOT org