Search result for sequence:
GACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG
common ontology terms
term enrichment score
TermScore
citrus0.324324
leaf0.308525
plant0.192308
agave0.181818
campos rupestres0.171053
minas gerais state0.171053
root0.157068
florida0.153846
cultivated habitat0.153846
rhizosphere0.146341
leaf endosphere0.141844
state of rhode island0.136986
guanajuato0.136986
soil0.131920
orchard0.125000
brazil0.125000
desert0.125000
austria0.117647
mexico0.113636
greenhouse0.112676
costa rica0.100000
barbacenia macrantha0.100000
beetle0.088889
leaf surface0.088889
food product0.086957
vellozia epidendroides0.086957
flower0.085106
germany0.084746
root endosphere0.074906
herbivorous beetle0.073529
agave tequiliana0.073529
poland0.070922
whole body0.068493
united states of america0.068361
skin0.064103
homo sapiens0.061069
vero beach, fl0.059701
immokalee, fl0.059701
gainesville, fl0.059701
quincy, fl0.059701
nida basin0.059701
agave deserti0.059701
other plants0.059701
nectar0.057971
digestive system0.051680
hunter gatherer0.046154
arm0.045977
peatland0.045802
LOWER IN other plants0.045455
state of california0.045249
province of quebec0.044444
woodland0.043956
fermented food product0.043478
stem0.041667
canada0.035714
olea europaea0.031008
sphagnum bog0.031008
venezuela0.031008
amerindian0.031008
ft. pierce, fl0.030769
onion0.030769
garlic0.030769
reunion island0.030769
ant0.030769
american cranberry0.030769
vaccinium macrocarpon0.030769
centris atripes0.030769
ruellia terminalis0.030769
crioceris duodecimpunctata0.030769
stachytarpheta frantzii0.030769
purple porterweed0.030769
scallion0.030769
dracaena fragrans0.030769
stem endosphere0.030769
adave salmiana0.030769
agave salmiana0.030769
LOWER IN soilwater0.030769
prunella vulgaris0.030769
woundwort0.030769
geranium pratense0.030769
meadow geranium0.030769
forearm0.030769
chuquisaca department0.030769
age 5-13 years0.030769
veronica chamaedrys0.030769
germander speedwell0.030769
allium cepa0.030303
commonwealth of massachusetts0.030303
bolivia0.029851
pair of nares0.029630
tree0.029412
LOWER IN soil0.029197
topsoil0.028986
depth 0-10cm0.028571
rural community0.028571
australia0.028369
forest0.027778
LOWER IN water0.027027
larval stage0.026316
child0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
olea europaea0.666667
citrus0.666667
sphagnum bog0.666667
leaf endosphere0.666667
beetle0.666667
leaf surface0.666667
root endosphere0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
peatland0.600000
plant chloroplast0.500000
olive tree0.500000
vero beach, fl0.500000
immokalee, fl0.500000
gainesville, fl0.500000
ft. pierce, fl0.500000
quincy, fl0.500000
state of rhode island0.500000
onion0.500000
garlic0.500000
orchard0.500000
reunion island0.500000
plant0.500000
alpine bog0.500000
plant surface0.500000
ant0.500000
costa rica0.500000
pseudomyrmex cubaensis0.500000
american cranberry0.500000
vaccinium macrocarpon0.500000
centris atripes0.500000
ruellia terminalis0.500000
barbacenia macrantha0.500000
campos rupestres0.500000
minas gerais state0.500000
crioceris duodecimpunctata0.500000
herbivorous beetle0.500000
nida basin0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
scallion0.500000
greenhouse0.500000
dracaena fragrans0.500000
epipremnum aureum0.500000
stem endosphere0.500000
crioceris quatuordecimpunctata0.500000
agave0.500000
adave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
vellozia epidendroides0.500000
miso0.500000
pseudomyrmex simplex0.500000
austin0.500000
LOWER IN australia0.500000
LOWER IN malaysia0.500000
LOWER IN seoul0.500000
agave deserti0.500000
aloe arborescens0.500000
aloe0.500000
radish0.500000
anoplophora glabripennis0.500000
trigona hyalinata0.500000
kimchi0.500000
LOWER IN days 1-90.500000
beaucarnea recurvata0.500000
centricnemus leucogrammus0.500000
LOWER IN nasopharynx0.500000
agave salmiana0.500000
LOWER IN inguinal region0.500000
LOWER IN axilla0.500000
LOWER IN sebum0.500000
malvaviscus penduliflorus0.500000
LOWER IN hedge bedstraw0.500000
LOWER IN galium mollugo0.500000
other plants0.500000
howea forsteriana0.500000
age 130.500000
alouatta pigra0.500000
howler monkey0.500000
central america0.500000
dry forest0.500000
LOWER IN tropical moist broadleaf forest biome0.500000
LOWER IN bulgaria0.500000
LOWER IN detritivorous beetle0.500000
lapland0.500000
mangrove0.500000
avicennia germinans0.500000
rhizophora mangle0.500000
chlorophytum comosum0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph<30.500000
LOWER IN ph>30.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
food processing factory0.500000
hadza0.500000
Fraction of annotations for the query sequences containing the term
TermScore
leaf0.301587
citrus0.214286
rhizosphere0.214286
united states of america0.150794
florida0.142857
soil0.126984
plant0.119048
root0.119048
cultivated habitat0.111111
brazil0.111111
agave0.111111
desert0.111111
campos rupestres0.103175
minas gerais state0.103175
state of rhode island0.079365
leaf endosphere0.079365
guanajuato0.079365
mexico0.079365
germany0.079365
orchard0.071429
austria0.071429
homo sapiens0.071429
greenhouse0.063492
food product0.055556
costa rica0.055556
barbacenia macrantha0.055556
flower0.047619
beetle0.047619
leaf surface0.047619
vellozia epidendroides0.047619
digestive system0.039683
herbivorous beetle0.039683
whole body0.039683
poland0.039683
agave tequiliana0.039683
root endosphere0.039683
state of california0.039683
skin0.039683
vero beach, fl0.031746
immokalee, fl0.031746
gainesville, fl0.031746
quincy, fl0.031746
nectar0.031746
nida basin0.031746
agave deserti0.031746
feces0.031746
other plants0.031746
peatland0.023810
stem0.023810
fermented food product0.023810
arm0.023810
hunter gatherer0.023810
woodland0.023810
canada0.023810
province of quebec0.023810
LOWER IN other plants0.023810
olea europaea0.015873
ft. pierce, fl0.015873
allium cepa0.015873
onion0.015873
garlic0.015873
reunion island0.015873
sphagnum bog0.015873
ant0.015873
larval stage0.015873
commonwealth of massachusetts0.015873
american cranberry0.015873
vaccinium macrocarpon0.015873
centris atripes0.015873
ruellia terminalis0.015873
crioceris duodecimpunctata0.015873
stachytarpheta frantzii0.015873
purple porterweed0.015873
scallion0.015873
dracaena fragrans0.015873
stem endosphere0.015873
adave salmiana0.015873
china0.015873
pair of nares0.015873
agave salmiana0.015873
venezuela0.015873
amerindian0.015873
tree0.015873
topsoil0.015873
depth 0-10cm0.015873
forest0.015873
LOWER IN soil0.015873
LOWER IN soilwater0.015873
LOWER IN water0.015873
prunella vulgaris0.015873
woundwort0.015873
geranium pratense0.015873
meadow geranium0.015873
australia0.015873
forearm0.015873
chuquisaca department0.015873
rural community0.015873
bolivia0.015873
age 5-13 years0.015873
child0.015873
Exp. ID User ID Description Date Region Flag Sequences
295amnonolive tree chloroplast (other plant chloroplast, chloroplast, olive tree, olea europaea)2018-02-10v4No1 / 1
98amnonhighfreq citrus, florida, leaf, vero beach, fl2017-04-01v4No1 / 2
98amnonhighfreq citrus, florida, leaf, immokalee, fl2017-04-01v4No1 / 3
98amnonhighfreq citrus, florida, leaf, gainesville, fl2017-04-01v4No1 / 3
98amnonhighfreq citrus, florida, leaf, ft. pierce, fl2017-04-01v4No1 / 4
98amnonhighfreq citrus, florida, leaf, quincy, fl2017-04-01v4No1 / 4
311amnonhighfreq united states of america, state of rhode island, allium cepa, onion, food product2018-04-09v4No1 / 4
311amnonhighfreq united states of america, state of rhode island, garlic, food product2018-04-09v4No1 / 6
415amnonhighfreq rhizosphere, soil, citrus, orchard, cultivated habitat, reunion island2018-11-27v4No1 / 6
130amnonhighfreq peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 7
408amnonhighfreq ant, costa rica, united states of america, pseudomyrmex cubaensis, larval stage2018-11-22v4No1 / 7
98amnonhighfreq citrus, rhizosphere, florida, root, quincy, fl2017-04-01v4No1 / 8
98amnonhighfreq citrus, rhizosphere, florida, root, immokalee, fl2017-04-01v4No1 / 9
98amnonhighfreq citrus, rhizosphere, florida, root, gainesville, fl2017-04-01v4No1 / 9
544amnonhighfreq commonwealth of massachusetts, united states of america, american cranberry, vaccinium macrocarpon, flower2019-08-04v4No1 / 11
59amnonhighfreq centris atripes, digestive system2017-02-03v4No1 / 11
501amnoncommon costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 11
548amnonhighfreq leaf endosphere, leaf, barbacenia macrantha, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 12
515amnonhighfreq crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 12
98amnonhighfreq citrus, rhizosphere, florida, root, vero beach, fl2017-04-01v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, ruellia terminalis2019-03-08v4No1 / 13
501amnonhighfreq costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 13
311amnonhighfreq united states of america, state of rhode island, food product, scallion2018-04-09v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, olea europaea2018-08-21v4No1 / 14
548amnonhighfreq stem endosphere, stem, barbacenia macrantha, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 15
515amnoncommon crioceris quatuordecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 15
360amnonhighfreq agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 15
548amnonhigh freq. in leaf surface of barbacenia macrantha (highfreq leaf surface, leaf, barbacenia macrantha, brazil, campos rupestres, minas gerais state)2019-08-17v4No1 / 16
360amnonhighfreq agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated habitat2018-08-21v4No1 / 16
548amnonhighfreq leaf endosphere, leaf, vellozia epidendroides, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 17
360amnonhighfreq agave, desert, root, root endosphere, mexico, guanajuato, agave tequiliana, cultivated habitat2018-08-21v4No1 / 17
59amnoncommon centris atripes, digestive system2017-02-03v4No1 / 20
311amnoncommon united states of america, state of rhode island, miso, fermented food product2018-04-09v4No1 / 22
408amnoncommon ant, costa rica, united states of america, larval stage, pseudomyrmex simplex2018-11-22v4No1 / 23
544amnoncommon commonwealth of massachusetts, united states of america, american cranberry, vaccinium macrocarpon, flower2019-08-04v4No1 / 25
59amnon high in austin united states of america compared to australia china malaysia seoul in apis mellifera digestive system 2017-02-02v4No1 / 25
311amnoncommon united states of america, state of rhode island, allium cepa, onion, food product2018-04-09v4No1 / 26
360amnonhighfreq agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 30
311amnoncommon united states of america, state of rhode island, garlic, food product2018-04-09v4No1 / 34
361amnoncommon leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 34
311amnoncommon united states of america, state of rhode island, food product, radish2018-04-09v4No1 / 36
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
243amnoncommon beetle, anoplophora glabripennis, digestive system, united states of america2017-11-15v4No1 / 38
360amnoncommon agave, leaf, leaf endosphere, desert, adave salmiana, guanajuato, mexico2018-08-21v4No1 / 39
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
59amnoncommon trigona hyalinata, digestive system2017-02-02v4No1 / 43
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
360amnoncommon agave, desert, root, root endosphere, agave deserti, state of california2018-08-21v4No1 / 52
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island fermented food product kimchi )2018-04-09v4No1 / 62
360amnoncommon agave, desert, root, root endosphere, mexico, guanajuato, agave tequiliana, cultivated habitat2018-08-21v4No1 / 62
91amnoncommon china, fermented food product, serofluid dish, jiangshui2017-03-08v4No1 / 70
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated habitat2018-08-21v4No1 / 78
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
515amnoncommon centricnemus leucogrammus, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 84
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
360amnoncommon agave, desert, root, root endosphere, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 87
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
548amnon high in plant root compared to rhizosphere in vellozia epidendroides brazil campos rupestres minas gerais state 2019-08-15v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
309amnon high in other plants compared to hedge bedstraw galium mollugo in rhizosphere germany 2018-04-05v4No1 / 110
98amnoncommon citrus, florida, leaf, vero beach, fl2017-04-01v4No1 / 115
311amnoncommon united states of america, state of rhode island, food product, scallion2018-04-09v4No1 / 121
548amnoncommon stem endosphere, stem, barbacenia macrantha, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 123
98amnoncommon citrus, florida, leaf, ft. pierce, fl2017-04-01v4No1 / 126
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 157
98amnoncommon citrus, florida, leaf, immokalee, fl2017-04-01v4No1 / 160
548amnoncommon leaf endosphere, leaf, barbacenia macrantha, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 164
98amnoncommon citrus, florida, leaf, quincy, fl2017-04-01v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey woodland central america 2017-03-03v4No1 / 193
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in beetle whole body 2019-04-19v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated habitat2018-08-21v4No1 / 210
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 213
98amnoncommon citrus, florida, leaf, gainesville, fl2017-04-01v4No1 / 215
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
548amnoncommon leaf endosphere, leaf, vellozia epidendroides, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 243
282amnoncommon soil, mangrove biome, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
357amnon high in ph<3 compared to ph>3 in soil topsoil depth 0-10cm forest woodland subpolar coniferous forest biome boreal forest 2018-08-19v4No1 / 297
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v4No1 / 355
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
309amnon high in other plants compared to festuca rubra red fescue grass in rhizosphere germany 2018-04-05v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
548amnoncommon stem, vellozia epidendroides, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 431
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, united states of america2018-11-27v4No1 / 494
98amnoncommon citrus, rhizosphere, florida, root, immokalee, fl2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, florida, vero beach, fl, root2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common leaf, vellozia epidendroides, brazil, campos rupestres, minas gerais state)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common leaf surface, leaf, barbacenia macrantha, brazil, campos rupestres, minas gerais state)2019-08-17v4No1 / 550
548amnoncommon root endosphere, barbacenia macrantha, root, brazil, campos rupestres, minas gerais state2019-08-17v4No1 / 575
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, south africa2018-11-27v4No1 / 600
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v4No1 / 617
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, reunion island2018-11-27v4No1 / 721
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated habitat2018-11-27v4No1 / 743
548amnoncommon in endopytic roots of Vellozia epidendroides (common plant, root, vellozia epidendroides, brazil, campos rupestres, minas gerais state)2019-08-15v4No1 / 800
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, china2018-11-27v4No1 / 830
517amnon high in forearm arm skin compared to feces in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
98amnoncommon citrus, rhizosphere, florida, root, quincy, fl2017-04-01v4No1 / 950
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, brazil2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, kingdom of spain2018-11-27v4No1 / 1099
84amnoncommon soil, peatland, wetland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm2017-03-06v4No1 / 1103
357amnon high in ph>5 compared to ph<5 in soil topsoil depth 0-10cm forest woodland temperate woodland biome temperate deciduos forest 2018-08-18v4No1 / 1171
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
415amnoncommon rhizosphere, soil, citrus, orchard, cultivated habitat, italy2018-11-27v4No1 / 1279
98amnoncommon citrus, rhizosphere, florida, root, gainesville, fl2017-04-01v4No1 / 1371
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715

Problems / suggestions? Please email info AT dbbact DOT org